View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15075_low_48 (Length: 240)
Name: NF15075_low_48
Description: NF15075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15075_low_48 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 7 - 56
Target Start/End: Original strand, 52911293 - 52911342
Alignment:
| Q |
7 |
agactatcagtatgaaattattaatctttcttacaatcacctgcaaacca |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52911293 |
agactatcagtatgaaattattaatctttcttacaatcacctgcagacca |
52911342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 98 - 167
Target Start/End: Original strand, 21665982 - 21666051
Alignment:
| Q |
98 |
tttggttccatcacttaaccaaaacaaaagaaaatcaattgtacataaaatattctttaatgaatactag |
167 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||| |||| ||| ||||| ||||| || |||||||| |
|
|
| T |
21665982 |
tttggttccatcacttaagcaaaataaaagaaaatcgattgcacaaaaaatcttcttgaagaaatactag |
21666051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 98 - 167
Target Start/End: Original strand, 54710502 - 54710571
Alignment:
| Q |
98 |
tttggttccatcacttaaccaaaacaaaagaaaatcaattgtacataaaatattctttaatgaatactag |
167 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||| |||| ||| ||||| ||||| || |||||||| |
|
|
| T |
54710502 |
tttggttccatcacttaagcaaaataaaagaaaatcgattgcacaaaaaatcttcttgaagaaatactag |
54710571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University