View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15075_low_49 (Length: 239)
Name: NF15075_low_49
Description: NF15075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15075_low_49 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 19 - 239
Target Start/End: Original strand, 7572357 - 7572577
Alignment:
| Q |
19 |
agtgtcttacaaatttcaaactactcatgcacacatgattctatcatatgtcatgacaatatttctttggtattgctttaaccaaagtccagatctgaat |
118 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7572357 |
agtgtcttacaaatttcaaacttctcatgcacacatgattctatcatatgtcatgacaatatttctttggtattgctttaaccaaagtccagatctgaat |
7572456 |
T |
 |
| Q |
119 |
cctctatagcagctgcagattcgttggatccaggtgcatgattcaactacacttaatgcatgtttggattggcgataagtttggcaaaatcacactgaat |
218 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7572457 |
cctctatagcagctgcagattcattggatccaggtgcatgattcaactacacttaatgcatgtttggattggcgataagtttggcaaaatcacactgaat |
7572556 |
T |
 |
| Q |
219 |
cacctcgattttgcgaacatc |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
7572557 |
cacctcgattttgcgaacatc |
7572577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 178 - 210
Target Start/End: Complemental strand, 6011300 - 6011268
Alignment:
| Q |
178 |
atgtttggattggcgataagtttggcaaaatca |
210 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
6011300 |
atgtttggattgacgataagtttggcaaaatca |
6011268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University