View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15075_low_50 (Length: 238)
Name: NF15075_low_50
Description: NF15075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15075_low_50 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 18 - 230
Target Start/End: Complemental strand, 34012179 - 34011959
Alignment:
| Q |
18 |
agtgttgcatgtttgaattaaaacttgagtgatgttgatcgggggccatggatggaggatatatgatcaannnnnnnnnnnnn--------atgaagaaa |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34012179 |
agtgttgcatgtttgaattaaaacttgagtgatgttgatcgggggccatggatggaggatatatgatcagagagagagagagagagagagaatgaagaaa |
34012080 |
T |
 |
| Q |
110 |
aaatgaagtggttagttagttatattaagggaaatgagatgcatgcaaagggtaagagtgaggtgggaagagagaacatgaaaggaaactgatggatggt |
209 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34012079 |
aaattgagtggttagttagttatattaagggaaatgagatgcatgcaaagggtaagagtgaggtgggaagagagaacatgaaaggaaactgatggatggt |
34011980 |
T |
 |
| Q |
210 |
agctagcttttggagtataat |
230 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
34011979 |
agctagcttttggagtataat |
34011959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University