View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15075_low_53 (Length: 235)
Name: NF15075_low_53
Description: NF15075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15075_low_53 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 15 - 219
Target Start/End: Complemental strand, 35501599 - 35501395
Alignment:
| Q |
15 |
gatgaaggttccaaagagtaatcaacttggtgttcagatcaaagatgggttgttctacaaattcactggatttcgtgatcaggttactttctgcccctcc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35501599 |
gatgaaggttccaaagagtaatcaacttggtgttcagatcaaagatgggttgttctacaaattcactggatttcgtgatcaggttactttctgcccctcc |
35501500 |
T |
 |
| Q |
115 |
tgaatgtccaattacatatatttgtagactaaggaattcaaatatctggtttgttttcttatgtttgttcctttgattaacattttgacagatatagata |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35501499 |
tgaatgtccaattacatatatttgtagactaaggaattcaaatatctggtttgttttcttatgtttgttcctttgactaacattttgacagatatagata |
35501400 |
T |
 |
| Q |
215 |
ttaat |
219 |
Q |
| |
|
||||| |
|
|
| T |
35501399 |
ttaat |
35501395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 15 - 98
Target Start/End: Original strand, 7069852 - 7069935
Alignment:
| Q |
15 |
gatgaaggttccaaagagtaatcaacttggtgttcagatcaaagatgggttgttctacaaattcactggatttcgtgatcaggt |
98 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
7069852 |
gatgaaggttccaaagacaaatcaactcggtgttcagatcaaagatgggttgttctacaaattcactggtttccgtgatcaggt |
7069935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University