View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15075_low_54 (Length: 234)
Name: NF15075_low_54
Description: NF15075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15075_low_54 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 33675365 - 33675582
Alignment:
| Q |
1 |
tttgaggaaaaattgttccttcttcatttgaaggattaacctaaaatagtaaaattcaatgtatctctgtacaccagatgaggtaaaagaacgtgggaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33675365 |
tttgaggaaaaattgttccttcttcatttgaaggattaacctaaaatagtaaaattcaatgtatctctgtacaccagatgaggtaaaagaacgtgggaaa |
33675464 |
T |
|
| Q |
101 |
cgtttgcttgtaacaacaaaataatgttgccttcatctcattaaaacatttgtcttttttaagctaaaataatgtatcaaattatcaatcatttaggcag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33675465 |
cgtttgcttgtaacaacaaaataatgttgccttcatctcattaaaacatttgtcttttttaagctaaaataatttatcaaattatcaatcatttaggcag |
33675564 |
T |
|
| Q |
201 |
taataaagtcgattgttt |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
33675565 |
taataaagtcgattgttt |
33675582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University