View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15075_low_55 (Length: 230)
Name: NF15075_low_55
Description: NF15075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15075_low_55 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 17 - 213
Target Start/End: Original strand, 37505514 - 37505710
Alignment:
| Q |
17 |
gaagagggttaaaaaacagagtagtttgaattcgaagctgtatagtagatttgatgctcaaattcatgcaattcaaggtgattctgatacttattcagaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37505514 |
gaagagggttaaaaaacagagtagtttgaattcgaagctgtatagtagatttgatgctcaaattcatgcaattcaaggtgattctgatacttatacagaa |
37505613 |
T |
 |
| Q |
117 |
gaaccttttgatttggagcggtataataagtggaaattggagttttcgttggaagggaaaaaggatgaaatggaaaagttgttaagagagaatgttg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37505614 |
gaaccttttgatttggagcggtataataagtggaaattggagttttcgttggaagggaaaaaggatgaaatggaaaagttgttaagagagaatgttg |
37505710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University