View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15075_low_56 (Length: 229)
Name: NF15075_low_56
Description: NF15075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15075_low_56 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 74 - 213
Target Start/End: Original strand, 9138811 - 9138950
Alignment:
| Q |
74 |
aagctgaaccatgaatcctctaactctcttgcttattttacctttctttactcagtttttggaagttgaacctgcaagaccaaaagtgctagggaaacca |
173 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9138811 |
aagcttaaccatgaatcctctaattctcttgcttattttacctttctttactcagtttttggaagttgaacctgcaagaccaaaagtgctagggaaacca |
9138910 |
T |
|
| Q |
174 |
agatttcctaactctcaaatcagtgtgatgggttttgttt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9138911 |
agatttcctaactctcaaatcagtgtgatgggttttgttt |
9138950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 19 - 72
Target Start/End: Original strand, 9138733 - 9138786
Alignment:
| Q |
19 |
atctacccttctttcttttatccacacaccaaactcatcttcaactagtattca |
72 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9138733 |
atctacccttctctcttttatccacacaccaaactcatcttcaactagtattca |
9138786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University