View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15076_high_10 (Length: 358)
Name: NF15076_high_10
Description: NF15076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15076_high_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 305; Significance: 1e-171; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 17 - 357
Target Start/End: Complemental strand, 14748710 - 14748371
Alignment:
| Q |
17 |
tctctacattagatttcactcataggggctgaaatcattatttacttatcaccgcaatggataacacatcttacaatcttctctatgtgggtgaaattat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14748710 |
tctctacattagatttcactcataggggctgaaatcattatttacttatcaccgcaatg-ataacacatcttacaatcttctctaagtgggtgaaattat |
14748612 |
T |
|
| Q |
117 |
tcttgtcttgtcttctgatactctccaccaacccatcatgcctaaattgtactacaaatttggtatgaagaatttagatcccttgaaatattttatgggt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14748611 |
tcttgtcttgtcttctgatactctccaccaacccatcatgcctaaattgtattccaaatttggtatgaagaatttagatcccttgaaatattttatgggt |
14748512 |
T |
|
| Q |
217 |
atatctattacacgacattaataaggtcttattattttactaaaagaaatatttcgaagaaatcaatgagcaagaacatatgtcttcttgcaaacaatct |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14748511 |
atatctattacacgacattaataaggtcttattattttactaaaagaaatatttcgaagaaatcaatgagcaagaacatatgtcttcttgcaaaccatct |
14748412 |
T |
|
| Q |
317 |
tctacagcggttgacacacaagttaaactctgtgctgcttc |
357 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||| |||||| |
|
|
| T |
14748411 |
tctacaccggttgacacacaagttaaactcagtggtgcttc |
14748371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University