View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15076_high_9 (Length: 396)
Name: NF15076_high_9
Description: NF15076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15076_high_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 92 - 317
Target Start/End: Original strand, 41546881 - 41547106
Alignment:
| Q |
92 |
ttgagtgagtgagtgactaagcgtcattcacgatcaagcggaccagaatcagccacaagatccaaaactcacccacgtgtcaccatcacatcaaccaagt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41546881 |
ttgagtgagtgagtgactaagcgtcattcacgatcaagcggaccagaatcagccacaagatccaaaactcatccacgtgtcaccatcacatcaaccaagt |
41546980 |
T |
|
| Q |
192 |
gattgcgtggaaccggtctaacgctgtcttcaccagtaacctgctatatccggtaatgttcgctacaacaaccgatagaaccggtaactcacggtcaatg |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41546981 |
gattgcgtggaaccggtctaacgctgtcttcaccagtaacctgctatatccggtaatgttcgctacaacaaccgatcgaaccggtaactcacggtcaatg |
41547080 |
T |
|
| Q |
292 |
ttataaactcttggggtttaaggtgg |
317 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
41547081 |
ttataaactcttggggtttaaggtgg |
41547106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 349 - 390
Target Start/End: Original strand, 41547138 - 41547179
Alignment:
| Q |
349 |
gtctctcataacagaactaacacgtttcttagattcatttca |
390 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41547138 |
gtctctcataacagaactaacacgtttcttagattcatttca |
41547179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University