View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15077_high_4 (Length: 364)
Name: NF15077_high_4
Description: NF15077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15077_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 307; Significance: 1e-173; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 20 - 354
Target Start/End: Original strand, 37890815 - 37891149
Alignment:
| Q |
20 |
gaaatgtcttatctgtgttgctctttcaggtcaaaaatattttatgattcaggtccagttgtactgcaaaattgttgtaataatgcctctctgctgaatt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37890815 |
gaaatgtcttatctgtgttgctctttcaggtcaaaaatattttatgattcaggtccagttgtactgcaaaattgttgtaataatgcctctctgctgaatt |
37890914 |
T |
 |
| Q |
120 |
ttcaaggttacctttcagatagaannnnnnnnaacttgacttgaacctgttgtgctgtggtagtgttattattaaaaccacccgtttgttttattcatcg |
219 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37890915 |
ttcaaggttacctttcagatagaattttttttaacttgacttgaacctgttgtgctgtggtagtgttattattaaaaccacccgtttgttttattcatcg |
37891014 |
T |
 |
| Q |
220 |
ctgaatttgtgtaagaacaatattcctggtctaacataaaatagaaaacccattttataatatcttttttaactaattcaaatgcatccacatatttcca |
319 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37891015 |
ctgaatttgtgtaagaacaaaattcctggtctaacataaaatagaaaacccattttataatatcttttttaactaattcaaatgcatccacatatttcca |
37891114 |
T |
 |
| Q |
320 |
ctaggttaggaagatttagcaatgtatatcctttg |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
37891115 |
ctaggttaggaagatttagcaatgtatatcctttg |
37891149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 35 - 134
Target Start/End: Original strand, 37185958 - 37186057
Alignment:
| Q |
35 |
tgttgctctttcaggtcaaaaatattttatgattcaggtccagttgtactgcaaaattgttgtaataatgcctctctgctgaattttcaaggttaccttt |
134 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
37185958 |
tgtttctctttcaggtcaaaaatattttatgattcaggtcgagttgaactgcaaaattgttgtaatagtgcttctctgctgaattttcaaggttaccttt |
37186057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University