View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15078_high_10 (Length: 229)
Name: NF15078_high_10
Description: NF15078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15078_high_10 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 16679468 - 16679240
Alignment:
| Q |
1 |
tcagatggcatcatcacagaatctagattccgaagcagccaagtttttacacaaactcctatacggcaattatcagaattaacagataaaaagaagagat |
100 |
Q |
| |
|
||||||||||| ||||| ||| |||||| ||||||||||||||||||||||||||||||| | |||| |||| |||| ||| |||||||||||||||| |
|
|
| T |
16679468 |
tcagatggcatattcacataatgtagattttgaagcagccaagtttttacacaaactcctattctgcaactatctgaataaactgataaaaagaagagat |
16679369 |
T |
|
| Q |
101 |
ctacataacatgaggaattcacaatgtccaaaatcactacattttgcataaattagggatatagaacatgaggtgagtacaaaccataggaacagttgac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16679368 |
ctacataacatgaggaattcacaatgtccaaaatcactacattttgcataaattaaggatatagaacatgaggtgagtacaaaccataggaacagttgac |
16679269 |
T |
|
| Q |
201 |
aacttaaatgctaccattcccctatttgc |
229 |
Q |
| |
|
||||| ||||||||||||||||||||||| |
|
|
| T |
16679268 |
aacttgaatgctaccattcccctatttgc |
16679240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University