View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15078_low_15 (Length: 202)
Name: NF15078_low_15
Description: NF15078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15078_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 20 - 183
Target Start/End: Original strand, 9700054 - 9700219
Alignment:
| Q |
20 |
catcagtgaagaatcccatgccagcaatgactatagctgttacatggtaccattgtgtacgagctgaatcaagagcctcaaggacttctaatcccatttt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9700054 |
catcagtgaagaatcccatgccagcaattactatagctgttacatggtaccattgtgtacgagctgaatcaagagcctcaaggacttctaatcccatttt |
9700153 |
T |
|
| Q |
120 |
ggt--nnnnnnnnnngaagactctctcaagttggtttttggagttaatttggtttaggtgtttatg |
183 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9700154 |
ggtaaaaaaaaaaaggaagactctctcaagttggtttttggagttaatttggtttaggtgtttatg |
9700219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University