View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15078_low_15 (Length: 202)

Name: NF15078_low_15
Description: NF15078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15078_low_15
NF15078_low_15
[»] chr1 (1 HSPs)
chr1 (20-183)||(9700054-9700219)


Alignment Details
Target: chr1 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 20 - 183
Target Start/End: Original strand, 9700054 - 9700219
Alignment:
20 catcagtgaagaatcccatgccagcaatgactatagctgttacatggtaccattgtgtacgagctgaatcaagagcctcaaggacttctaatcccatttt 119  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9700054 catcagtgaagaatcccatgccagcaattactatagctgttacatggtaccattgtgtacgagctgaatcaagagcctcaaggacttctaatcccatttt 9700153  T
120 ggt--nnnnnnnnnngaagactctctcaagttggtttttggagttaatttggtttaggtgtttatg 183  Q
    |||            |||||||||||||||||||||||||||||||||||||||||||||||||||    
9700154 ggtaaaaaaaaaaaggaagactctctcaagttggtttttggagttaatttggtttaggtgtttatg 9700219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University