View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1507_high_26 (Length: 334)
Name: NF1507_high_26
Description: NF1507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1507_high_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 1e-59; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 178 - 315
Target Start/End: Complemental strand, 47477857 - 47477720
Alignment:
| Q |
178 |
ggtttcaaagttcggtttagggtgtatggccctcagtggaggatacaatgatcctcttcctgaagaaattggcatttccgtaattaatcatgcattcagt |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47477857 |
ggtttcaaagttcggtttagggtgtatggccctcagtggaggatacaatgatcctcttcctgaagaaattggcatttccgtaattaatcatgcattcagt |
47477758 |
T |
|
| Q |
278 |
aaaggcatcacnnnnnnngacaccgctgatgtttatgg |
315 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |
|
|
| T |
47477757 |
aaaggcatcactttttttgacaccgctgatgtttatgg |
47477720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 1 - 105
Target Start/End: Complemental strand, 47478037 - 47477933
Alignment:
| Q |
1 |
acaaacacaaactgaactaattcctcatgtctcacttggaacccaaggctttcaggtatcatcacttcactcacttgtacacttacacttacatatacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47478037 |
acaaacacaaactgaactaattcctcatgtctcacttggaacccaaggctttcaggtatcatcacttcactcacttgtacacttacacttacatatacaa |
47477938 |
T |
|
| Q |
101 |
ttgtc |
105 |
Q |
| |
|
|||| |
|
|
| T |
47477937 |
atgtc |
47477933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 178 - 283
Target Start/End: Complemental strand, 47474365 - 47474260
Alignment:
| Q |
178 |
ggtttcaaagttcggtttagggtgtatggccctcagtggaggatacaatgatcctcttcctgaagaaattggcatttccgtaattaatcatgcattcagt |
277 |
Q |
| |
|
||||||||| || ||||| |||||||||| |||| ||||| ||||||||||||||||||||| || ||| |||||||||||||| |||| |||||| |
|
|
| T |
47474365 |
ggtttcaaaattgggtttcgggtgtatgggactcactggagcttacaatgatcctcttcctgaacaagatggtatttccgtaattaactatgctttcagt |
47474266 |
T |
|
| Q |
278 |
aaaggc |
283 |
Q |
| |
|
|||||| |
|
|
| T |
47474265 |
aaaggc |
47474260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 8 - 57
Target Start/End: Complemental strand, 47487078 - 47487029
Alignment:
| Q |
8 |
caaactgaactaattcctcatgtctcacttggaacccaaggctttcaggt |
57 |
Q |
| |
|
||||| || |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
47487078 |
caaaccgagctaattcctcatgttacacttggaacccaaggctttcaggt |
47487029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University