View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1507_high_38 (Length: 290)
Name: NF1507_high_38
Description: NF1507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1507_high_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 151 - 272
Target Start/End: Complemental strand, 41504474 - 41504353
Alignment:
| Q |
151 |
atgccgttgtcgttggtacttcatgtatactcgagtatggcagttagttaggaataagaaaaaagacaataaagatagaagttgcttgctccataatctt |
250 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41504474 |
atgccgtggtcgttggtacttcatgtatactcgagtatggcagttagttaggaataagaaaaaagacaataaagatagaagttgcttgctccataatctt |
41504375 |
T |
 |
| Q |
251 |
aggaacccaaaaaagagaaaca |
272 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
41504374 |
aggaacccaaaaaagagaaaca |
41504353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 6 - 80
Target Start/End: Complemental strand, 41504547 - 41504473
Alignment:
| Q |
6 |
aggagcacagatatgctggtgtaggttagatgattaaatatgctaccagcccctaccacaaatactagtactcat |
80 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41504547 |
aggagcacagatatgctggtgtaggttagatgattaaatatgctaccagcccctaccacaaatactagtactcat |
41504473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University