View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1507_high_49 (Length: 254)
Name: NF1507_high_49
Description: NF1507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1507_high_49 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 177
Target Start/End: Complemental strand, 5190210 - 5190034
Alignment:
| Q |
1 |
tctttccatgttagagggaattgaatcaacaatgttttattcactctcacagtcacataagcttgtaaatccactgtcaatttcgagctatagttaatct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5190210 |
tctttccatgttagagggaattgaatcaacaatgttttattcactctcacagtcacataagcttgtaaatccactgtcaatttctagctatagttaatct |
5190111 |
T |
|
| Q |
101 |
tgacccttaatcactcttaaaaggtgtcggtgatatgatatttataaactggttacctaattaagcatagaaagagg |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
5190110 |
tgacccttaatcactcttaaaaggtgtcggtgatatgatatttataaagtggctacctaattaagcatagaaagagg |
5190034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 236
Target Start/End: Complemental strand, 5190009 - 5189950
Alignment:
| Q |
177 |
gaattgaagaagattataaagattagagagagaatgccctaaaaaactaggagctttgtg |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5190009 |
gaattgaagaagattataaagattagagagagaatgccctaaaaaactaggagctttgtg |
5189950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University