View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1507_high_64 (Length: 233)
Name: NF1507_high_64
Description: NF1507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1507_high_64 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 18 - 216
Target Start/End: Original strand, 34360898 - 34361095
Alignment:
| Q |
18 |
atggaggaggctttatcctattattttagtatggaggcttgagcatcttacttttatgaatgaagtacttcatttcaacggatccnnnnnnnatagtttg |
117 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
34360898 |
atggaggagactttatcctattattttagtatggaggcttgagcatcttacttttatgaatgaagtacttcatttcattggatcctttttt-atagtttg |
34360996 |
T |
 |
| Q |
118 |
aaactgagaagttgcaactcttctcttttcctatctctatgtatacaatgcatgtttacttagttctgttcaagatgctagcatggactgaggctttta |
216 |
Q |
| |
|
||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34360997 |
aaagtgagaagttgcaactcttcccttttcctatctctatgtatacaatgcatgtttacttagctctgttcaagatgctagcatggactgaggctttta |
34361095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 18 - 149
Target Start/End: Original strand, 5584688 - 5584814
Alignment:
| Q |
18 |
atggaggaggctttatcctattattttagtatggaggcttgagcatcttacttttatgaatgaagtacttcatttcaacggatccnnnnnnnatagtttg |
117 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| ||||| || || || |||||||| |
|
|
| T |
5584688 |
atggaggagactttatcctattattttagtatgaaggcttgagcatcttacttttgtgaatgaagcacttcctt-----ggtacctttttttatagtttg |
5584782 |
T |
 |
| Q |
118 |
aaactgagaagttgcaactcttctcttttcct |
149 |
Q |
| |
|
||| ||||||||||||||||||||| |||||| |
|
|
| T |
5584783 |
aaagtgagaagttgcaactcttctcctttcct |
5584814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University