View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1507_high_65 (Length: 229)
Name: NF1507_high_65
Description: NF1507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1507_high_65 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 17 - 220
Target Start/End: Original strand, 32280774 - 32280977
Alignment:
| Q |
17 |
ctttttggaattgaccagtgcagaaaccaacaagtgtctactctatgtattcacgtgagttttgnnnnnnnaacaaactcttttcgtatgagttgaagaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
32280774 |
ctttttggaattgaccagtgcagaaaccaacaagtgtctactctatgtattcacgtgagttttgtttttttaacaaagtcttttcgtatgagttgaagaa |
32280873 |
T |
 |
| Q |
117 |
ttgcaaaagacaaaactcaattctctagaacaagaaaaaccttaggtcttgtcattcagcatttttctctgtcaagacgttctcatggaatgcagtataa |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32280874 |
ttgcaaaagacaaaactcaattctctagaacaagaaaaaccttaggtcttgtcattcagcatttttctctgtcaagacgttctcatggaatgcagtaaaa |
32280973 |
T |
 |
| Q |
217 |
tcta |
220 |
Q |
| |
|
|||| |
|
|
| T |
32280974 |
tcta |
32280977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University