View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1507_low_41 (Length: 290)

Name: NF1507_low_41
Description: NF1507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1507_low_41
NF1507_low_41
[»] chr2 (2 HSPs)
chr2 (151-272)||(41504353-41504474)
chr2 (6-80)||(41504473-41504547)


Alignment Details
Target: chr2 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 151 - 272
Target Start/End: Complemental strand, 41504474 - 41504353
Alignment:
151 atgccgttgtcgttggtacttcatgtatactcgagtatggcagttagttaggaataagaaaaaagacaataaagatagaagttgcttgctccataatctt 250  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41504474 atgccgtggtcgttggtacttcatgtatactcgagtatggcagttagttaggaataagaaaaaagacaataaagatagaagttgcttgctccataatctt 41504375  T
251 aggaacccaaaaaagagaaaca 272  Q
    ||||||||||||||||||||||    
41504374 aggaacccaaaaaagagaaaca 41504353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 6 - 80
Target Start/End: Complemental strand, 41504547 - 41504473
Alignment:
6 aggagcacagatatgctggtgtaggttagatgattaaatatgctaccagcccctaccacaaatactagtactcat 80  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41504547 aggagcacagatatgctggtgtaggttagatgattaaatatgctaccagcccctaccacaaatactagtactcat 41504473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University