View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1507_low_42 (Length: 287)
Name: NF1507_low_42
Description: NF1507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1507_low_42 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 16 - 272
Target Start/End: Complemental strand, 8238474 - 8238222
Alignment:
| Q |
16 |
ggtgatgaagaaacattcacattatttgcagtactattctatagaagaaatccccccaagctcatgtatctcagaagagaagaagtaggcaattggttaa |
115 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8238474 |
ggtgatgaaaaaacattcacattatttgcagtactattctatagaagaaatccccccaagctcatgtatctcagaagagaagaagtaggcaattggttaa |
8238375 |
T |
 |
| Q |
116 |
attgtttctaacttaaggactgactgagacacaacgaagtagtcgagctctttgctaaaaaatgtgtactaatatagtatccaatgtgagcacgaatgaa |
215 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| || |
|
|
| T |
8238374 |
attgtttctaacttgaggactga----gacacaacgaagtagtcgagctctttgctaaaaaatgtgtgctaatatagtatcgaatgtgagcacgaattaa |
8238279 |
T |
 |
| Q |
216 |
atatatgtttggtctcacattgaatttgctcaaatcagggttagtctctctaatttc |
272 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8238278 |
atgtatgtttggtctcacattgaatttgctcaaatcagggttagtctctctaatttc |
8238222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University