View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1507_low_46 (Length: 274)
Name: NF1507_low_46
Description: NF1507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1507_low_46 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 16 - 274
Target Start/End: Original strand, 7301206 - 7301464
Alignment:
| Q |
16 |
aatattcagaacaaatccgaatcaactccgaaaccgttacacaactctttgatgattctctcaaccttgatttcaccatctctaattgcgccaccttcaa |
115 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7301206 |
aatattcagaacaaatcctaatcaactccgaaaccgttacacaactctttgatgattctctcagccttgatttcaccatctctaattgcgccaccttcaa |
7301305 |
T |
 |
| Q |
116 |
caatttcttcccatcactgacgctaacaccatcctccttcggcatcgccggtttctccgccggcgttttgatgatcaatccatccaaccgaatacgattc |
215 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7301306 |
caatttcttcacatcactgacgctaacaccatcctccttcggcatcgccggtttctccgccggcgttttgatgatcaatccatccaaccgaatacgattc |
7301405 |
T |
 |
| Q |
216 |
ctaccattgtccattgttttcagcttctccatcaggtttggttgatgaagctctgattt |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7301406 |
ctaccattgtccattgttttcagcttctccatcaggtttggttgatgaagctctgattt |
7301464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University