View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1507_low_47 (Length: 266)
Name: NF1507_low_47
Description: NF1507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1507_low_47 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 4 - 248
Target Start/End: Original strand, 21028328 - 21028572
Alignment:
| Q |
4 |
catgcatagatcaacatcagtgtatgatacaaaatcagaaatggctaagggaagaatattttcctactatatttggtttatgctagccttctcatcttga |
103 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
21028328 |
catgcatagatcaacatcagtttatgatgtaaaatcagaaatggctaaaggaagaatattttcctacaatatttggtttatgctagccttctcatcttga |
21028427 |
T |
|
| Q |
104 |
cattaagaggaacctctttgtaggatggaaccttctcagctgctcttcgcaacggtcttccaaaagaatgccttggagcttcatttcttaaaccagagct |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |||||||||||||||| |||||| |
|
|
| T |
21028428 |
cattaagaggaacctctttgtaggatggaaccttctcagctgcccttcgcaacggtcttccaaaagaatgtcttggtgcttcatttcttaaactagagct |
21028527 |
T |
|
| Q |
204 |
ttctcctctttcagttttcacagctggagtactcagcttgttatt |
248 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
21028528 |
ttctcctctttcagttttcacagatggagtactcagcttgatatt |
21028572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University