View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1507_low_49 (Length: 264)
Name: NF1507_low_49
Description: NF1507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1507_low_49 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 27121179 - 27121422
Alignment:
| Q |
1 |
aagtgatcctttctttagtttagagaggaggttctagcattctcggtgtaacgaaataaaggaagagagtaggatgatcaaaagtcaaatgtaagcaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
27121179 |
aagtgatcctttctttagtttagagaggaggttctagcattctcaaagtaacgaaataaaggaagagagtaggatgatcaaaaggcaaatgtaagcaaca |
27121278 |
T |
|
| Q |
101 |
tgttacaaccattatactttcggacaaaaaggagaatagaatgactttggtaaagattgagacaaatatannnnnnnnnnnnnnnnnngggttgcacagg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27121279 |
tgttacaaccattatactttcggacaaaaaggagaatagaatgactttggtaaagattgagacaaatat----tttttttgaatttttgggttgcacagg |
27121374 |
T |
|
| Q |
201 |
atcggactatttataaagtatagaaggttgtacttaattaaggcacatat |
250 |
Q |
| |
|
| |||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27121375 |
a--ggactatttataaagtatagaaagttgtacttaattaaggcacatat |
27121422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University