View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1507_low_52 (Length: 255)
Name: NF1507_low_52
Description: NF1507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1507_low_52 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 9e-85; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 79 - 245
Target Start/End: Complemental strand, 47201548 - 47201382
Alignment:
| Q |
79 |
caggttgggttggcaccactttgggatgatgggtatgggaatcgcactgttgaagattactttgctgcatccaaagagatttgcaagtttgatggtggcc |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47201548 |
caggttgggttggcaccactttgggatgatgggtatgggaatcgcactgttgaagattactttgctgcatccaaagagatttgcaagtttgatggtggcc |
47201449 |
T |
|
| Q |
179 |
caccacgttggttttgcccaatcgaatgtgcttctcctttccaaggttctcccacccctatgcttct |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
47201448 |
caccacgttggttttgcccaatcgaatgtgcttctcctttccaaggttctcccacccttatgtttct |
47201382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 47201626 - 47201579
Alignment:
| Q |
1 |
aaccaaaacaaggttcctcttttattgcgttctactaataatgttgtt |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47201626 |
aaccaaaacaaggttcctcttttattgcgttctactaataatgttgtt |
47201579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University