View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1507_low_58 (Length: 249)
Name: NF1507_low_58
Description: NF1507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1507_low_58 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 10 - 166
Target Start/End: Original strand, 29977774 - 29977931
Alignment:
| Q |
10 |
gcacagacaaatttaacatatacatttaattgaatcaagataactaggtagtaaaatgtgattattttgatatgttgaaatatttatagatttctagttc |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29977774 |
gcacagacaaatttaatatatacatttaattgaatcaagataactaggtagtaaaatgtgattattttgatatgttgaaatatttatagatttctagttc |
29977873 |
T |
 |
| Q |
110 |
ttagagcgaaataa-nnnnnnnatggaatatagggaattaatttctagttcttcatgt |
166 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29977874 |
ttagagcgaaataattttttttatggaatatagggaattaatttctagttcttcatgt |
29977931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University