View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1507_low_63 (Length: 237)
Name: NF1507_low_63
Description: NF1507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1507_low_63 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 29977927 - 29977970
Alignment:
| Q |
179 |
catgtgtatgcaaggattgaagttgaaaacatagaataatttgt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
29977927 |
catgtgtatgcaaggattgaagttgaaaacataaaataatttgt |
29977970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University