View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1507_low_67 (Length: 236)
Name: NF1507_low_67
Description: NF1507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1507_low_67 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 24 - 229
Target Start/End: Complemental strand, 51118539 - 51118333
Alignment:
| Q |
24 |
caaaaatttgcacttcaacagatgatacaa-tcccaaacaactaaatatcgctcaaataaatagttataaacttgaaaatatttgtcgagtactcaatcc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51118539 |
caaaaatttgcacttcaacagatgatacaaatcccaaacaactaaatatcgctcaaataaatagttataaacttgaaaatatttgtcgagtactcaatcc |
51118440 |
T |
|
| Q |
123 |
ttatctgtttgcagccgctgatcggtatggcttcaatagctacctgaagtgcaaagcaagacattcaagatgttgcaaacattaatatgaccatgactat |
222 |
Q |
| |
|
||||||||| |||||| |||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51118439 |
ttatctgttagcagccactgatccgtatggcttcaatagctacctgaagtgcaaagcaaggcattcaagatgttgcaaacattaatatgaccatgactat |
51118340 |
T |
|
| Q |
223 |
atctctg |
229 |
Q |
| |
|
||||||| |
|
|
| T |
51118339 |
atctctg |
51118333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University