View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1507_low_80 (Length: 206)
Name: NF1507_low_80
Description: NF1507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1507_low_80 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 53 - 180
Target Start/End: Complemental strand, 1067829 - 1067702
Alignment:
| Q |
53 |
agaggttagagagagagaaagagtttcatggtgctgtttgtaacagaacagaacagaacaatgagtacctcgtgcgtgtggttttgctttttatatgttt |
152 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1067829 |
agaggttagagaaagagaaagagtttcacggtgctgtttgtaacagaacagaacagaacaatgagtacctcgtgcgtgtggttttgctttttatatgttt |
1067730 |
T |
|
| Q |
153 |
atagcagtgagtgtttttcttgtgagta |
180 |
Q |
| |
|
|||| ||||||||||||||||||||||| |
|
|
| T |
1067729 |
atagtagtgagtgtttttcttgtgagta |
1067702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University