View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15080_high_9 (Length: 352)
Name: NF15080_high_9
Description: NF15080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15080_high_9 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 11 - 352
Target Start/End: Original strand, 40646106 - 40646443
Alignment:
| Q |
11 |
gtaacaaaggtaagatgcgggtggttgcaacttgcgccaactacaagtaaaagctgcaattgagtgctaagtatgaaaaaccaatttctccattgtgtca |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40646106 |
gtaaccaaggtaagatgcgggtggttgcaacttgcgccaactacaagtaaaagctgcaattgagtgctaagtatgaaaaaccaatttctccattgtgtca |
40646205 |
T |
|
| Q |
111 |
gataaggccgcaaataataccattatagtataacattaacaacacaaccatagccataggacttaggagcctttattatttatttattgttgatcaaagg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40646206 |
gataaggccgcaaataataccattatagtatgacattaacaacacaaccatagccataggacttaggagccttta----ttatttattgttgatcaaagg |
40646301 |
T |
|
| Q |
211 |
aaacacatgaatgaattttgacaggctacatacaccacaccaatccactttactaaccaaccactaattttacttannnnnnnnnnnnnnnnncacttca |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40646302 |
aaacacatgaatgaattttgacaggctacatacaccacaccaatccactttactaaccaaccactaattttactttttttttttttttcgtttcacttca |
40646401 |
T |
|
| Q |
311 |
atcaacatcattgaatcttcaaaaaccccaatattgaccttc |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40646402 |
atcaacatcattgaatcttcaaaaaccccaatattgaccttc |
40646443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University