View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15080_low_8 (Length: 352)
Name: NF15080_low_8
Description: NF15080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15080_low_8 |
 |  |
|
| [»] chr3 (33 HSPs) |
 |  |
|
| [»] chr7 (43 HSPs) |
 |  |
|
| [»] chr8 (35 HSPs) |
 |  |
|
| [»] chr5 (22 HSPs) |
 |  |
|
| [»] chr4 (40 HSPs) |
 |  |
|
| [»] chr2 (37 HSPs) |
 |  |
|
| [»] scaffold0032 (1 HSPs) |
 |  |
|
| [»] chr6 (26 HSPs) |
 |  |
|
| [»] scaffold1348 (1 HSPs) |
 |  |
|
| [»] scaffold0119 (2 HSPs) |
 |  |
|
| [»] scaffold0044 (1 HSPs) |
 |  |
|
| [»] scaffold0038 (1 HSPs) |
 |  |
|
| [»] scaffold0067 (1 HSPs) |
 |  |
|
| [»] scaffold0053 (1 HSPs) |
 |  |
|
| [»] scaffold0352 (1 HSPs) |
 |  |
|
| [»] scaffold0360 (1 HSPs) |
 |  |  |
|
| [»] scaffold0495 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 30)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 16 - 254
Target Start/End: Original strand, 6708638 - 6708875
Alignment:
| Q |
16 |
aaaagatacgatttgattccaattttgtaatctacacttgaaatattatgaaaaggagagaccacaacacttgtgtgcaagtatacttctcttcacacat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6708638 |
aaaagatacgatttgattccaattttgtaatctacacttgaaatattatgaaaaggagagaccacaacacttg-gtgcaagtatacttctcttcacacat |
6708736 |
T |
 |
| Q |
116 |
acaaaaggacaagtaaaattagtggatctgtggatgttctgtattatcccaaatcattaaataatcagccactgagtttgttcgttctccaacggtgaaa |
215 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6708737 |
acaaaagaacaagtaaaattagtggatctgtggatgttctgtattatcccaaatcattaaataatcagccactgagtttgttcgttcaccaacggtgaaa |
6708836 |
T |
 |
| Q |
216 |
ttttaatccaaatgaactaaattaaatataaaatataat |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6708837 |
ttttaatccaaatgaactaaattaaatataaaatataat |
6708875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 256 - 352
Target Start/End: Original strand, 28455874 - 28455970
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28455874 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgttgtgacccgggttcgaacccgggacctcacagttgtgtgtgagtt |
28455970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 265 - 352
Target Start/End: Original strand, 39276359 - 39276446
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
39276359 |
tcctagctcaactggcaaatgccgaaattgcaaggccggacgttgtgacccgggttcgaacccgggacctcacagttatgtgtgagtt |
39276446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 254 - 352
Target Start/End: Complemental strand, 41761541 - 41761443
Alignment:
| Q |
254 |
ttgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||| ||| |||||| |||||||||||||||| |||||||||||||||||||||||||| |||||||||| | |||||||||||||||||||||||| |
|
|
| T |
41761541 |
ttgtctagaagtcctagttcaactggcaaatgccgaaattgcaaggccggacgttgtgacccgggttcgaacccaggacctcacagttgtgtgtgagtt |
41761443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 254 - 352
Target Start/End: Original strand, 48660020 - 48660118
Alignment:
| Q |
254 |
ttgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
48660020 |
ttgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgttatgacccgggttcgaacccgggatctcacagttgtgtgtgagtt |
48660118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 256 - 352
Target Start/End: Original strand, 32007074 - 32007170
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| ||||||||||||||||||| ||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32007074 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacccgggacctcacagttgtgtgtgagtt |
32007170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 261 - 352
Target Start/End: Original strand, 5943686 - 5943777
Alignment:
| Q |
261 |
gaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||||||||||||| |||||| |||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
5943686 |
gaattcctagctcaactgacaaatgccgaaattgcaaggccggacgtcgtgacccgggttcgaactcaggacctcacagttgtttgtgagtt |
5943777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 265 - 348
Target Start/End: Original strand, 29587261 - 29587344
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtg |
348 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
29587261 |
tcctagctcaactggcaaatgccgaaattgcaaggccggacgtcgtgacctgggttcgaacccgggacctcacaattgtgtgtg |
29587344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 256 - 352
Target Start/End: Complemental strand, 5055916 - 5055820
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| |||||||||| |||||||||||| ||||||||||||||||||| ||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5055916 |
gtctagaagtcctagctcagctggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacccgggacctcacagttgtgtgtgagtt |
5055820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 256 - 352
Target Start/End: Original strand, 41808202 - 41808298
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| ||||||||||||||||||| ||||| |||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
41808202 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacccggaacctcacagttgtgtgtgagtt |
41808298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 255 - 352
Target Start/End: Complemental strand, 45813140 - 45813043
Alignment:
| Q |
255 |
tgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||| ||| |||||||||||||| |||||||| ||||||||||| ||||| | |||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45813140 |
tgtctagaagtcctagctcaactgacaaatgccgaaattgcaaggtcggacatcgtgacccgggttcgaacccgggacctcacagttgtgtgtgagtt |
45813043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 256 - 352
Target Start/End: Original strand, 192415 - 192511
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| |||||||||||||| ||||||| ||||||||||||||||||||||||| | | |||||||| | |||||||||||||||||||||||| |
|
|
| T |
192415 |
gtctagaagtcctagctcaactgacaaatgctaaaattgcaaggccggacgttgtgatccgtgttcgaacccaggacctcacagttgtgtgtgagtt |
192511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 265 - 349
Target Start/End: Original strand, 35945806 - 35945890
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtga |
349 |
Q |
| |
|
||||||||||||||| ||||||| |||||| ||||| |||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
35945806 |
tcctagctcaactggtaaatgccgaaattgtaaggctggacgttgtgacctgggttcgaacccggaacctcacagttgtgtgtga |
35945890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 256 - 352
Target Start/End: Original strand, 20748 - 20844
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||| ||||||||||||||||| |||||||||||| ||||| |||||| || ||||||| |||||||||||||||||||||||||| |
|
|
| T |
20748 |
gtctagaagtcctaactcaactggcaaatgccgaaattgcaaggcaggacgccgtgacccggattcgaacccgggacctcacagttgtgtgtgagtt |
20844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 256 - 352
Target Start/End: Complemental strand, 29994511 - 29994415
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| ||||||||||||| ||||| ||| | |||||||||| || ||||||||| ||||||||||||| |
|
|
| T |
29994511 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccagacgtcatgatccgggttcgaacccgagacctcacaattgtgtgtgagtt |
29994415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 267 - 352
Target Start/End: Complemental strand, 46447494 - 46447409
Alignment:
| Q |
267 |
ctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||| ||||| || ||| |||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
46447494 |
ctagttcaactggcaaatgccgaaattgcaaggctcgacgtcgtaacccgggttcgaacccgggacctcacagttatgtgtgagtt |
46447409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 272 - 346
Target Start/End: Original strand, 35224356 - 35224430
Alignment:
| Q |
272 |
tcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtg |
346 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| ||||| |||||||||| | |||||||||||||||||| |
|
|
| T |
35224356 |
tcaactggcaaatgcgaaaaatgcaaggccggacgtcatgacccgggttcgaacccaggacctcacagttgtgtg |
35224430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 291 - 352
Target Start/End: Complemental strand, 50106289 - 50106228
Alignment:
| Q |
291 |
attgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
50106289 |
attgcaaggccgaacgttgtgacccgggttcgaacccgggacctcacagttatgtgtgagtt |
50106228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 268 - 342
Target Start/End: Original strand, 47111469 - 47111543
Alignment:
| Q |
268 |
tagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttg |
342 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| ||||||| |||||||||||| |||| | ||||||| |||||| |
|
|
| T |
47111469 |
tagctcaactgacaaatgccgaaattgcaaggtcggacgtcgtgacctgggtttgaacccaggacctcgcagttg |
47111543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 256 - 352
Target Start/End: Original strand, 11688263 - 11688359
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| |||||||||||||| ||||| | |||||||||| ||| ||||||||||| |||||||| || |||| ||| ||||||||||||||| |
|
|
| T |
11688263 |
gtctagaagtcctagctcaactgacaaatatcgaaattgcaagcccgaacgttgtgaccctggttcgaattcaggacttcagagttgtgtgtgagtt |
11688359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 352
Target Start/End: Original strand, 7059491 - 7059563
Alignment:
| Q |
280 |
caaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||| ||||||||||||| | ||||| |||||| ||||||||| | ||||||||||||||||||||||| |
|
|
| T |
7059491 |
caaatgtcaaaattgcaaggtcagacgtcgtgacccgggttcgaatctgagacctcacagttgtgtgtgagtt |
7059563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 265 - 352
Target Start/End: Original strand, 21938951 - 21939038
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||||||||||| ||||||| |||||| ||||||||| || ||| | || |||||| | |||||||||||||||||| ||||| |
|
|
| T |
21938951 |
tcctagctcaactggtaaatgccgaaattgtaaggccggatgtcatgatccggattcgaatccaggacctcacagttgtgtgcgagtt |
21939038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 254 - 324
Target Start/End: Original strand, 45294656 - 45294726
Alignment:
| Q |
254 |
ttgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaa |
324 |
Q |
| |
|
|||||| ||| ||||||||||||| ||||||||| |||||||||| |||||| | ||||| ||||||||| |
|
|
| T |
45294656 |
ttgtctagaagtcctagctcaactagcaaatgccgaaattgcaagaccggacatcatgacccgggttcgaa |
45294726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 265 - 334
Target Start/End: Complemental strand, 3688355 - 3688286
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacct |
334 |
Q |
| |
|
|||||| ||||||| ||||| |||||||||||||| |||||||||||| ||| ||||||| ||| |||| |
|
|
| T |
3688355 |
tcctagttcaactgacaaattccaaaattgcaaggaaggacgttgtgacttggattcgaacccggaacct |
3688286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 271 - 352
Target Start/End: Original strand, 7275696 - 7275777
Alignment:
| Q |
271 |
ctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||||||||||| | |||||| |||| |||||||| |||| || ||||||| ||| || |||||||||||| |||||| |
|
|
| T |
7275696 |
ctcaactggcaaatgtcgaaattgtaaggtcggacgttatgactcggattcgaacccggaacttcacagttgtgtatgagtt |
7275777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 256 - 352
Target Start/End: Complemental strand, 2089033 - 2088937
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| |||||||||||||||||||| | |||||| |||| | ||| | ||||| |||||||||||| | |||||||| |||| |||||||| |
|
|
| T |
2089033 |
gtctagaagtcctagctcaactggcaaatatcgaaattgtaaggtcagacatcgtgactcgggttcgaactcagaacctcacaattgtatgtgagtt |
2088937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 316 - 352
Target Start/End: Complemental strand, 41039371 - 41039335
Alignment:
| Q |
316 |
gggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41039371 |
gggttcgaacccgggacctcacagttgtgtgtgagtt |
41039335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 265 - 343
Target Start/End: Original strand, 9385750 - 9385826
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgt |
343 |
Q |
| |
|
||||| || |||||||||||||| || || ||||| ||||||| |||||| |||||| ||| ||||||||||||||||| |
|
|
| T |
9385750 |
tcctaacttaactggcaaatgccgaa-ttacaaggtcggacgtcgtgacc-gggttcaaacgcgggacctcacagttgt |
9385826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 272 - 352
Target Start/End: Original strand, 26032814 - 26032897
Alignment:
| Q |
272 |
tcaactggcaaatgccaaaattgcaaggccgg---acgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||| |||||||| |||||| |||| ||| |||| |||||| |||||||||| || ||||||||||| |||||||||| |
|
|
| T |
26032814 |
tcaactgacaaatgccgaaattgtaaggtcggcggacgtcgtgacccgggttcgaacctggaacctcacagttttgtgtgagtt |
26032897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 265 - 349
Target Start/End: Original strand, 49783716 - 49783800
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtga |
349 |
Q |
| |
|
||||| ||||| ||||||||| | ||||||||||| || |||| ||| |||||||||| ||| ||||||||||||| ||||| |
|
|
| T |
49783716 |
tcctaactcaattggcaaatgtcgaaattgcaaggtcgaacgtcatgattcgggttcgaacccggaacctcacagttgtatgtga |
49783800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 85; Significance: 2e-40; HSPs: 33)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 256 - 352
Target Start/End: Complemental strand, 43247778 - 43247682
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43247778 |
gtctagaagtcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaacccgggacctcacagttgtgtgtgagtt |
43247682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 251 - 352
Target Start/End: Complemental strand, 29689615 - 29689514
Alignment:
| Q |
251 |
taattgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgag |
350 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||| ||||||||||||||||||| ||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
29689615 |
taattgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacccgggacctcacagttgtgtgtgag |
29689516 |
T |
 |
| Q |
351 |
tt |
352 |
Q |
| |
|
|| |
|
|
| T |
29689515 |
tt |
29689514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 252 - 352
Target Start/End: Complemental strand, 7824586 - 7824486
Alignment:
| Q |
252 |
aattgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagt |
351 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||| ||||||||||||||||||| ||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7824586 |
aattgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacccgggacctcacagttgtgtgtgagt |
7824487 |
T |
 |
| Q |
352 |
t |
352 |
Q |
| |
|
| |
|
|
| T |
7824486 |
t |
7824486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 253 - 352
Target Start/End: Complemental strand, 55018165 - 55018066
Alignment:
| Q |
253 |
attgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||| ||| ||||| ||||||||||||||| ||||||||||||||||||||| |||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
55018165 |
attgtctagaagtcctaactcaactggcaaatgtcaaaattgcaaggccggacgtcgtgacccgggttcgaacccgggacctcacagttgtgtgtgagtt |
55018066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 252 - 352
Target Start/End: Original strand, 33334604 - 33334704
Alignment:
| Q |
252 |
aattgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagt |
351 |
Q |
| |
|
|||||||| ||| ||||||||||||| ||||||||| ||||||||| |||||||||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
33334604 |
aattgtctagaagtcctagctcaacttgcaaatgccgaaattgcaaagccggacgttgtgacctgagttcgaatccgggacctcacagttgtgtgtgagt |
33334703 |
T |
 |
| Q |
352 |
t |
352 |
Q |
| |
|
| |
|
|
| T |
33334704 |
t |
33334704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 256 - 352
Target Start/End: Complemental strand, 51666053 - 51665957
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
51666053 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacctgggttcgaacccgggaccttacagttgtgtgtgagtt |
51665957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 256 - 352
Target Start/End: Original strand, 4601425 - 4601521
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| ||||||||||||||||||| ||||| |||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
4601425 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacccggaacctcacagttgtgtgtgagtt |
4601521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 256 - 352
Target Start/End: Complemental strand, 54151809 - 54151713
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| ||||||||||||||||||| ||||| |||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
54151809 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacccgggacctcacagttgtgtatgagtt |
54151713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 256 - 352
Target Start/End: Original strand, 54158266 - 54158362
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| ||||||||||||||||||| ||| | |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
54158266 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgatccgggttcgaacccgggacctcacagttgtgtgtgagtt |
54158362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 267 - 352
Target Start/End: Original strand, 28844515 - 28844600
Alignment:
| Q |
267 |
ctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||| |||||||||| || |||||||||||||||||||||| |
|
|
| T |
28844515 |
ctagctcaactgacaaatgccgaaattgcaaggccggacgttgtgacccgggttcgaacctggaacctcacagttgtgtgtgagtt |
28844600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 267 - 352
Target Start/End: Complemental strand, 35461596 - 35461511
Alignment:
| Q |
267 |
ctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||| | |||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
35461596 |
ctagctcaactggcaaatgccgaaattgcaaggtcggacgttgtgatccgggttcgaacccggaacctcacagttgtgtgtgagtt |
35461511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 268 - 352
Target Start/End: Complemental strand, 36229110 - 36229026
Alignment:
| Q |
268 |
tagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| ||| | |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36229110 |
tagctcaactggcaaatgccgaaattgcaaggccggacgtcatgatccgggttcgaacccgggacctcacagttgtgtgtgagtt |
36229026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 268 - 352
Target Start/End: Complemental strand, 3113111 - 3113027
Alignment:
| Q |
268 |
tagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| || ||| | |||||||| ||||| |||||||||||||||||||| |
|
|
| T |
3113111 |
tagctcaactggcaaatgccgaaattgcaaggccggacgtcgtaacccgagttcgaacccgggatctcacagttgtgtgtgagtt |
3113027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 272 - 352
Target Start/End: Complemental strand, 9349788 - 9349708
Alignment:
| Q |
272 |
tcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||| |||| | |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9349788 |
tcaactggcaaatgccgaaattgcaaggtcggacgtcgtgatccgggttcgaacccgggacctcacagttgtgtgtgagtt |
9349708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 256 - 345
Target Start/End: Original strand, 1778851 - 1778940
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgt |
345 |
Q |
| |
|
|||| ||| |||||||||||||| |||||||| ||||||||||||||||| |||||||| |||||||||| ||| |||||||| |||||| |
|
|
| T |
1778851 |
gtctagaagtcctagctcaactgacaaatgccgaaattgcaaggccggacattgtgacccgggttcgaacccggaacctcacaattgtgt |
1778940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 256 - 352
Target Start/End: Complemental strand, 42392933 - 42392837
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| ||||||||||| ||||||| ||| | ||| |||||| |||||||||||| ||||||||||||| |
|
|
| T |
42392933 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggtcggacgtcatgatccgggctcgaacccgggacctcacaattgtgtgtgagtt |
42392837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 271 - 352
Target Start/End: Original strand, 29750636 - 29750717
Alignment:
| Q |
271 |
ctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||| |||||| || |||||||| | ||||||||| ||||| ||||||| |
|
|
| T |
29750636 |
ctcaactggcaaatgccgaaattgcaaggctggacgtcgtgacccggattcgaactagagacctcacatttgtgcgtgagtt |
29750717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 256 - 337
Target Start/End: Original strand, 41377584 - 41377665
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcac |
337 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||| |||||||||||| ||| | ||||||||| ||||||||||| |
|
|
| T |
41377584 |
gtctagaagtcctagctcaactggcaaatgccaaaattgtaaggccggacgtcatgatccaggttcgaacccgggacctcac |
41377665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 272 - 352
Target Start/End: Complemental strand, 475392 - 475312
Alignment:
| Q |
272 |
tcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||| |||||| ||||||||||| ||||||| ||| | |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
475392 |
tcaactgggaaatgctgaaattgcaaggtcggacgtcatgatccgggttcgaactcggaacctcacagttgtgtgtgagtt |
475312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 256 - 352
Target Start/End: Original strand, 52500838 - 52500934
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||||||||||||||||||| | |||||| |||||||||||| ||| | |||||||||| | |||||||||||||||||||||| |
|
|
| T |
52500838 |
gtctagaagtcctagctcaactggcaaatgtcgaaattgtaaggccggacgtcatgatccgggttcgaacctgaaacctcacagttgtgtgtgagtt |
52500934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 265 - 325
Target Start/End: Complemental strand, 51112583 - 51112523
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaac |
325 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
51112583 |
tcctagctcaactggcaaatgccgaaattgctaggccggacgtcatgaccggggttcgaac |
51112523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 289 - 352
Target Start/End: Complemental strand, 38257398 - 38257335
Alignment:
| Q |
289 |
aaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||| | | |||||||| ||||||||||||| |
|
|
| T |
38257398 |
aaattgcaaggtcggacgtcgtgacctgggttcgaacccagaacctcacaattgtgtgtgagtt |
38257335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 271 - 352
Target Start/End: Original strand, 43775238 - 43775319
Alignment:
| Q |
271 |
ctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||||||||||||| |||||| |||| ||||||||||||| || ||||||| ||| | ||||||||||| | |||||| |
|
|
| T |
43775238 |
ctcaactggcaaatgccgaaattgtaaggtcggacgttgtgacttgcgttcgaatccggaatctcacagttgtatttgagtt |
43775319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 268 - 352
Target Start/End: Complemental strand, 448991 - 448907
Alignment:
| Q |
268 |
tagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||||||| |||||| |||||||| |||||||||||| |||| | | ||||||| ||||||||||||||| |||||||| |
|
|
| T |
448991 |
tagctcaactgacaaatgtcaaaattgtaaggccggacgtcgtgatccgaattcgaacctaggacctcacagttgtttgtgagtt |
448907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 256 - 352
Target Start/End: Complemental strand, 32001552 - 32001456
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||| ||||||||| ||||||| |||||| ||||||| || | ||| | |||||||||||| || |||||||||||||||||||| |
|
|
| T |
32001552 |
gtctagaagtcctacctcaactggtaaatgccgaaattgtaaggccgaacatcttgaaccaggttcgaactcgagatctcacagttgtgtgtgagtt |
32001456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 268 - 349
Target Start/End: Original strand, 27230679 - 27230759
Alignment:
| Q |
268 |
tagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtga |
349 |
Q |
| |
|
||||||||||| |||||| ||||||||||||| ||| | ||||||||| ||| ||||||||| |||||||||||||||| |
|
|
| T |
27230679 |
tagctcaactgataaatgctgaaattgcaaggccagacatcgtgacctggattcaaactcggga-ttcacagttgtgtgtga |
27230759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 265 - 337
Target Start/End: Complemental strand, 2590920 - 2590848
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcac |
337 |
Q |
| |
|
||||| ||||||||| ||||| | |||||||||||||| || | |||| |||||||||||| | ||||||||| |
|
|
| T |
2590920 |
tcctaactcaactggaaaatgtcgaaattgcaaggccgaacatcgtgatctgggttcgaaccctggacctcac |
2590848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 256 - 352
Target Start/End: Original strand, 7958569 - 7958665
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||| |||||||| |||||| |||||||| || || ||| | |||| | |||||||||| ||||||||||||||| ||||| |||| |
|
|
| T |
7958569 |
gtctagaagtcctacctcaactgacaaatgtcaaaattgtaaagcaggatgccgtgatccgggttcgaacccgggacctcacagttatgtgtaagtt |
7958665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 268 - 314
Target Start/End: Complemental strand, 45686143 - 45686097
Alignment:
| Q |
268 |
tagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacc |
314 |
Q |
| |
|
|||||||||| ||||||||| |||||| |||||||||||| |||||| |
|
|
| T |
45686143 |
tagctcaactagcaaatgccgaaattgaaaggccggacgtcgtgacc |
45686097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 290 - 352
Target Start/End: Complemental strand, 47635099 - 47635037
Alignment:
| Q |
290 |
aattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||| | ||||||| ||||| ||||| |||| |
|
|
| T |
47635099 |
aattgcaaggtcggacattgtgacctgggttcgaatccaggacctcgcagttatgtgtaagtt |
47635037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 267 - 352
Target Start/End: Original strand, 50729535 - 50729620
Alignment:
| Q |
267 |
ctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||||||| |||||||| |||||| |||| | ||||| |||| |||| ||||||| | |||||| ||||| | |||||||| |
|
|
| T |
50729535 |
ctagctcaactgacaaatgccgaaattgtaaggtcagacgtcgtgatctggattcgaacatgagacctcgcagttttatgtgagtt |
50729620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 267 - 352
Target Start/End: Complemental strand, 50783314 - 50783229
Alignment:
| Q |
267 |
ctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||||||| |||||||| |||||| |||| | ||||| |||| |||| ||||||| | |||||| ||||| | |||||||| |
|
|
| T |
50783314 |
ctagctcaactgacaaatgccgaaattgtaaggtcagacgtcgtgatctggattcgaacatgagacctcgcagttttatgtgagtt |
50783229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 265 - 325
Target Start/End: Original strand, 42296720 - 42296780
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaac |
325 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| || ||||| |||||||||| |
|
|
| T |
42296720 |
tcctagctcaactgcaaaatgccaaaattgttaggccggatgtcatgaccggggttcgaac |
42296780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 82; Significance: 1e-38; HSPs: 43)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 255 - 352
Target Start/End: Original strand, 44083939 - 44084036
Alignment:
| Q |
255 |
tgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44083939 |
tgtctagaagtcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacccgggttcgaacccgggacctcacagttgtgtgtgagtt |
44084036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 256 - 352
Target Start/End: Original strand, 40058238 - 40058334
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
40058238 |
gtctagaagtcctaactcaactggcaaatgccaaaattgcaaggccggacgttgtgacccgggttcgaacccgggacctcacagttgtgtatgagtt |
40058334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 253 - 352
Target Start/End: Complemental strand, 31770663 - 31770564
Alignment:
| Q |
253 |
attgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||| |||||||||||||||| || ||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
31770663 |
attgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggatgtcatgacccgggttcgaacccgggacctcacagttgtgtgtgagtt |
31770564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 254 - 352
Target Start/End: Original strand, 23358183 - 23358281
Alignment:
| Q |
254 |
ttgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||| ||| |||||||||||||||||||| || ||||||||||||||||||| || ||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
23358183 |
ttgtctagaagtcctagctcaactggcaaataccgaaattgcaaggccggacgtcgtaacccgggttcgaacccgggacctcacagttgtgtgtgagtt |
23358281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 265 - 346
Target Start/End: Complemental strand, 7162907 - 7162826
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtg |
346 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
7162907 |
tcctagctcaactggcaaatgccgaaattgtaaggccggacgttgtgacccgggttcgaactcgggacctcacaattgtgtg |
7162826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 256 - 352
Target Start/End: Original strand, 4106738 - 4106834
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||||| ||||||||||||||| ||||||||||||||||||| ||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4106738 |
gtctagaagtcctagcccaactggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacccgggacctcacagttgtgtgtgagtt |
4106834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 265 - 352
Target Start/End: Complemental strand, 27229597 - 27229510
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||| |||||||| |||||| | ||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
27229597 |
tcctaactcaactgacaaatgtcgaaattgcaaggccggacgtcgtgacctgggttcgaacccgggacctcacagttgtgtgtgagtt |
27229510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 265 - 352
Target Start/End: Complemental strand, 43753873 - 43753786
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||||| ||||||||||||||||| ||| ||||||||||||| |||||||| |
|
|
| T |
43753873 |
tcctagttcaactggcaaatgccgaaattgcaaggccggacgtcgtgacctgggttcgaacccggaacctcacagttgtatgtgagtt |
43753786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 254 - 348
Target Start/End: Original strand, 2146634 - 2146728
Alignment:
| Q |
254 |
ttgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtg |
348 |
Q |
| |
|
|||||| ||| ||||||||||||||| ||||||| |||||||||||||||||||||||||| |||||||||| | ||||||||||||||||||| |
|
|
| T |
2146634 |
ttgtctagaagtcctagctcaactggaaaatgccgaaattgcaaggccggacgttgtgacccgggttcgaacccaagacctcacagttgtgtgtg |
2146728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 254 - 348
Target Start/End: Complemental strand, 25112377 - 25112283
Alignment:
| Q |
254 |
ttgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtg |
348 |
Q |
| |
|
|||||| ||| |||||||||||||||||||| || ||||||||||| ||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25112377 |
ttgtctagaagtcctagctcaactggcaaataccgaaattgcaaggtcggacgtcatgacctgggttcgaacccgggacctcacagttgtgtgtg |
25112283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 255 - 352
Target Start/End: Complemental strand, 25546404 - 25546307
Alignment:
| Q |
255 |
tgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||| ||| ||||||||||||||| ||||||| ||||||||||||||||||| ||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
25546404 |
tgtctagaagtcctagctcaactggtaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaatccgggacctcacagttgtgtgtgagtt |
25546307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 265 - 349
Target Start/End: Original strand, 8439087 - 8439171
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtga |
349 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||||||||||| || ||||||| | ||||||||||||||||||||| |
|
|
| T |
8439087 |
tcctagttcaactggcaaatgccaaaattgcaaggtcggacgttgtgacccggattcgaacccaggacctcacagttgtgtgtga |
8439171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 271 - 352
Target Start/End: Original strand, 4107324 - 4107405
Alignment:
| Q |
271 |
ctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4107324 |
ctcaactggcaaatgccgaaattgcaaggccggacgtcacgacccgggttcgaacccgggacctcacagttgtgtgtgagtt |
4107405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 265 - 352
Target Start/End: Complemental strand, 29484874 - 29484787
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| ||| ||||||| |||| |||||||||||| |||| |||||||| |
|
|
| T |
29484874 |
tcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgatctgggtttgaacccgggacctcacaattgtatgtgagtt |
29484787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 268 - 352
Target Start/End: Complemental strand, 5772935 - 5772851
Alignment:
| Q |
268 |
tagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||||| |||||||||| ||||||||||| ||||| ||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5772935 |
tagctcaacgggcaaatgccgaaattgcaaggtcggacaatgtgacccgggttcgaactcgaaacctcacagttgtgtgtgagtt |
5772851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 265 - 352
Target Start/End: Complemental strand, 47250370 - 47250283
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| ||||| |||||||||| |||| ||| ||||||||||||||| |
|
|
| T |
47250370 |
tcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacctgggatctcttagttgtgtgtgagtt |
47250283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 256 - 352
Target Start/End: Original strand, 43203306 - 43203402
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| |||||| | |||||||||||||| |||||| ||||| ||||| |||||| |||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
43203306 |
gtctagaagtcctagatgaactggcaaatgccgaaattgtaaggcgggacgccgtgacccgggttcgaacccgggaccttacagttgtgtgtgagtt |
43203402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 274 - 352
Target Start/End: Original strand, 41183833 - 41183911
Alignment:
| Q |
274 |
aactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||||||||||| | ||||||||||| |||||||||| |
|
|
| T |
41183833 |
aactggcaaatgccgaaattgcaaggccggacgtcttgacctgggttcgaacccaatacctcacagttatgtgtgagtt |
41183911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 267 - 352
Target Start/End: Original strand, 11355834 - 11355919
Alignment:
| Q |
267 |
ctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| |||||| |||||||| ||||||||||| |||||||| ||| |||| ||||||| ||||| |||||||||||||||||||| |
|
|
| T |
11355834 |
ctagttcaactaacaaatgccgaaattgcaaggtcggacgttatgatctggattcgaacccgggatctcacagttgtgtgtgagtt |
11355919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 271 - 352
Target Start/End: Original strand, 28603026 - 28603107
Alignment:
| Q |
271 |
ctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||| |||||||| |||||||| || ||| ||||| |||| |||||||| |
|
|
| T |
28603026 |
ctcaactggcaaatgccgaaatcgcaaggccggacgtcgtgacctgagttcgaacccgagacttcacaattgtatgtgagtt |
28603107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 271 - 352
Target Start/End: Original strand, 38033744 - 38033825
Alignment:
| Q |
271 |
ctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||||||||||||| |||||| |||| ||||| |||||| | |||||| || |||||||||||||||||||||||||| |
|
|
| T |
38033744 |
ctcaactggcaaatgccgaaattgtaaggtcggacattgtgatccgggttcaaatccgggacctcacagttgtgtgtgagtt |
38033825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 267 - 352
Target Start/End: Original strand, 48146764 - 48146849
Alignment:
| Q |
267 |
ctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||||||| |||||| ||||||||||| | || || |||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
48146764 |
ctagctcaactgaaaaatgcagaaattgcaaggtcagatgtcgtgacccgggttcgaacccgggacctcacagttgtgtgtgagtt |
48146849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 289 - 352
Target Start/End: Complemental strand, 47570813 - 47570750
Alignment:
| Q |
289 |
aaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
47570813 |
aaattgcaaggccggacgtcatgacccgggttcgaacccgggatctcacagttgtgtgtgagtt |
47570750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 273 - 346
Target Start/End: Complemental strand, 4001953 - 4001880
Alignment:
| Q |
273 |
caactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtg |
346 |
Q |
| |
|
||||||| ||||| | |||||||||||||||| || |||||| |||||||||||||||||||| ||| |||||| |
|
|
| T |
4001953 |
caactggaaaatgtcgaaattgcaaggccggatgtcgtgacccgggttcgaactcgggacctctcagctgtgtg |
4001880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 255 - 352
Target Start/End: Complemental strand, 10220601 - 10220504
Alignment:
| Q |
255 |
tgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||| ||| ||||| ||||||||||||| |||||||||| ||||| |||||| ||| ||||||||||| || ||||||||||| |||||||||| |
|
|
| T |
10220601 |
tgtctagaagtcctaactcaactggcaaaagccaaaattgtaaggcaggacgtcatgatctgggttcgaatccgaaacctcacagttttgtgtgagtt |
10220504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 265 - 346
Target Start/End: Complemental strand, 42081735 - 42081655
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtg |
346 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||| || ||||||||| | |||||||||| | |||||||||||||||||| |
|
|
| T |
42081735 |
tcctagctcagctggcaaatgtcaaaattgcaagatcgaacgttgtgatccgggttcgaac-ctggacctcacagttgtgtg |
42081655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 271 - 343
Target Start/End: Original strand, 13887186 - 13887258
Alignment:
| Q |
271 |
ctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgt |
343 |
Q |
| |
|
||||||||||||||||| || ||||||| |||||||| |||||| ||||||||| ||| ||||||||||||| |
|
|
| T |
13887186 |
ctcaactggcaaatgccgaacttgcaagaccggacgtcgtgacccaggttcgaacccggaacctcacagttgt |
13887258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 256 - 352
Target Start/End: Original strand, 47557781 - 47557877
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||| ||||||||| ||||||| ||||| ||||| || |||| ||||| |||||||||| ||| ||||||||||||| |||||||| |
|
|
| T |
47557781 |
gtctagaagtcctaactcaactggtaaatgccgaaattacaaggtcgcacgtcatgacccgggttcgaacccggaacctcacagttgtatgtgagtt |
47557877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 289 - 352
Target Start/End: Complemental strand, 38781303 - 38781240
Alignment:
| Q |
289 |
aaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||||||||| | || |||||| || ||||||| |||||||||||||||||||||||||| |
|
|
| T |
38781303 |
aaattgcaaggccgaatgtcgtgacccggattcgaacccgggacctcacagttgtgtgtgagtt |
38781240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 289 - 352
Target Start/End: Complemental strand, 39514078 - 39514015
Alignment:
| Q |
289 |
aaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||||||||||||||| |||||| | |||||||| |||||||| |||||| |||||||||| |
|
|
| T |
39514078 |
aaattgcaaggccggacgtcgtgacccgagttcgaacccgggaccttacagttatgtgtgagtt |
39514015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 267 - 325
Target Start/End: Original strand, 29255728 - 29255786
Alignment:
| Q |
267 |
ctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaac |
325 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |||| | |||||||||| |
|
|
| T |
29255728 |
ctagctcaactggcaaatgccaaaattgcaaggttggacgtcgtgatccgggttcgaac |
29255786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 254 - 352
Target Start/End: Complemental strand, 47961085 - 47960987
Alignment:
| Q |
254 |
ttgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||| ||| || || ||||||| ||||||||||||||| ||||| | ||||| ||| | |||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
47961085 |
ttgtctagaagtcttaactcaacttgcaaatgccaaaattacaaggtcagacgtcatgaaccgggttcgaacccgggacctcgtagttgtgtgtgagtt |
47960987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 254 - 352
Target Start/End: Complemental strand, 48444282 - 48444184
Alignment:
| Q |
254 |
ttgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||| ||| |||||||||||||| ||||||| |||||| ||| | |||||| |||| |||||||||||| | | || |||||||||||||| |||| |
|
|
| T |
48444282 |
ttgtctagaagtcctagctcaactgaaaaatgccgaaattgtaagactggacgtcgtgatctgggttcgaaccctgtacttcacagttgtgtgtaagtt |
48444184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 267 - 352
Target Start/End: Original strand, 5587291 - 5587376
Alignment:
| Q |
267 |
ctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||| | |||| | |||||||||| | |||||||||| || ||||||||| |
|
|
| T |
5587291 |
ctagctcaactgacaaatgccgaaattgcaagtccggacatcgtgatccgggttcgaacccaggacctcacatttacgtgtgagtt |
5587376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 267 - 352
Target Start/End: Original strand, 5592252 - 5592337
Alignment:
| Q |
267 |
ctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||| | |||| | |||||||||| | |||||||||| || ||||||||| |
|
|
| T |
5592252 |
ctagctcaactgacaaatgccgaaattgcaagtccggacatcgtgatccgggttcgaacccaggacctcacatttacgtgtgagtt |
5592337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 268 - 352
Target Start/End: Complemental strand, 15634995 - 15634911
Alignment:
| Q |
268 |
tagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||||| ||||||||| |||||| || | ||||||| |||||| || |||||| ||| || ||||||||||||||||||| |
|
|
| T |
15634995 |
tagctcaactagcaaatgccgaaattgtaaagtcggacgtcgtgacccggattcgaaaccggaacttcacagttgtgtgtgagtt |
15634911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 254 - 341
Target Start/End: Complemental strand, 32606460 - 32606373
Alignment:
| Q |
254 |
ttgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagtt |
341 |
Q |
| |
|
|||||| ||| | ||| |||||||| ||||| || ||||||||||||||||||| |||||| ||||||||| || ||||| |||||| |
|
|
| T |
32606460 |
ttgtctagaagttctaactcaactgacaaataccgaaattgcaaggccggacgtcgtgacccaggttcgaacccgagaccttacagtt |
32606373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 267 - 352
Target Start/End: Original strand, 46427371 - 46427456
Alignment:
| Q |
267 |
ctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||| |||||| |||| || |||||| ||| |||||||||||||||||||||| |
|
|
| T |
46427371 |
ctagctcaactgacaaatatcaaaattgcaaggttggacgtcatgactcggattcgaatccggaacctcacagttgtgtgtgagtt |
46427456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 255 - 352
Target Start/End: Complemental strand, 27915710 - 27915612
Alignment:
| Q |
255 |
tgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacc-tgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||| ||| ||||| ||||||||| |||||| ||||||||||| ||||||| |||||| || |||||||| || ||||||||||||| |||||| |
|
|
| T |
27915710 |
tgtctagaagtcctaactcaactggtaaatgctgaaattgcaaggtcggacgtcgtgaccttgagttcgaacctaagatctcacagttgtgtatgagtt |
27915612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 256 - 314
Target Start/End: Original strand, 34763454 - 34763512
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacc |
314 |
Q |
| |
|
|||| ||| ||||||||||||||| ||||| | ||||||||||| ||||||| |||||| |
|
|
| T |
34763454 |
gtctagaagtcctagctcaactggaaaatgtcgaaattgcaagggcggacgtcgtgacc |
34763512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 265 - 307
Target Start/End: Complemental strand, 43171058 - 43171016
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgt |
307 |
Q |
| |
|
||||| |||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
43171058 |
tcctaactcaactgacaaatgccgaaattgcaaggccggacgt |
43171016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 265 - 325
Target Start/End: Complemental strand, 7312573 - 7312512
Alignment:
| Q |
265 |
tcctagctcaactggcaaa-tgccaaaattgcaaggccggacgttgtgacctgggttcgaac |
325 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| || ||||| |||||||||| |
|
|
| T |
7312573 |
tcctagctcaactggcaaaatgccaaaattgttaggccggatgtcatgaccggggttcgaac |
7312512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 271 - 352
Target Start/End: Complemental strand, 25050071 - 25049990
Alignment:
| Q |
271 |
ctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||| | ||||||| |||||| |||| | ||||| ||||||||| || |||||| || ||||||||||| |||||||| |
|
|
| T |
25050071 |
ctcaactagaaaatgccgaaattgaaaggtcagacgtcgtgacctggatttgaactcatgatctcacagttgtatgtgagtt |
25049990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 81; Significance: 4e-38; HSPs: 35)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 256 - 352
Target Start/End: Complemental strand, 35779625 - 35779529
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35779625 |
gtctagaagtcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacccgggttcgaacccgggacctcacagttgtgtgtgagtt |
35779529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 255 - 352
Target Start/End: Original strand, 32333113 - 32333210
Alignment:
| Q |
255 |
tgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32333113 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgttgtgacccgggttcgaacccgggacctcacagttgtgtgtgagtt |
32333210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 254 - 352
Target Start/End: Complemental strand, 1470 - 1372
Alignment:
| Q |
254 |
ttgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||| ||| | |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1470 |
ttgtctagaagttctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgaccctggttcgaacccgggacctcacagttgtgtgtgagtt |
1372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 254 - 352
Target Start/End: Original strand, 28817254 - 28817352
Alignment:
| Q |
254 |
ttgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
28817254 |
ttgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgttgtgacccgggttcgaacccgggatctcacagttgtgtgtgagtt |
28817352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 256 - 352
Target Start/End: Complemental strand, 6602646 - 6602550
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| ||||||||||||||||||| ||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6602646 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacccgggacctcacagttgtgtgtgagtt |
6602550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 256 - 352
Target Start/End: Complemental strand, 6678099 - 6678003
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| ||||||||||||||||||| ||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6678099 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacccgggacctcacagttgtgtgtgagtt |
6678003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 256 - 352
Target Start/End: Original strand, 7792661 - 7792757
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| |||||||||||| |||||||||||| |||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
7792661 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggctggacgttgtgactcgggttcgaacccgggatctcacagttgtgtgtgagtt |
7792757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 255 - 352
Target Start/End: Complemental strand, 42192768 - 42192671
Alignment:
| Q |
255 |
tgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||| ||||||||||||||||||| ||||| | |||||||| ||||| |||||||||||||||||||| |
|
|
| T |
42192768 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacccgagttcgaacccgggatctcacagttgtgtgtgagtt |
42192671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 256 - 352
Target Start/End: Complemental strand, 70651 - 70555
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| ||||||||||| ||||||| ||||| ||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
70651 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggtcggacgtcatgacccgggtttgaacccgggacctcacagttgtgtgtgagtt |
70555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 256 - 352
Target Start/End: Original strand, 7813322 - 7813418
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| |||||||||||| ||||||||| |||||||||||||||| |||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7813322 |
gtctagaagtcctagctcaaccggcaaatgctgaaattgcaaggccggatgttgtgactcgggttcgaacccgggacctcacagttgtgtgtgagtt |
7813418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 265 - 352
Target Start/End: Original strand, 39303318 - 39303405
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |||| |||||| |||| || ||||||||||||||||||||||| |
|
|
| T |
39303318 |
tcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacatgggtttgaacccgagacctcacagttgtgtgtgagtt |
39303405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 255 - 352
Target Start/End: Complemental strand, 4531111 - 4531014
Alignment:
| Q |
255 |
tgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||| ||| ||||||||||| ||||||||||| |||||||||||| |||||| ||||| |||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
4531111 |
tgtctagaagtcctagctcaattggcaaatgccgaaattgcaaggctggacgtcatgacccgggttcgaacccgggacctcacagctgtgtgtgagtt |
4531014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 267 - 352
Target Start/End: Original strand, 39435293 - 39435378
Alignment:
| Q |
267 |
ctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||| ||| |||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
39435293 |
ctagctcaactggcaaatgtcaaaattgcaaggtcggacgtcatgatctgggttcgaacccgagacctcacagttgtgtgtgagtt |
39435378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 267 - 352
Target Start/End: Original strand, 40911232 - 40911316
Alignment:
| Q |
267 |
ctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||||| |||||||||| |||||||||||| |||||||||||| |
|
|
| T |
40911232 |
ctagctcaactggcaaatgccgaaattgcaaggccggacgtcgtgacccgggttcgaac-cgggacctcacaactgtgtgtgagtt |
40911316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 268 - 352
Target Start/End: Complemental strand, 1078764 - 1078680
Alignment:
| Q |
268 |
tagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||||||| ||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1078764 |
tagctcaactggtaaatgccgaaattgcaaggccggacgtcatgacccaggttcgaacccgggacctcacagttgtgtgtgagtt |
1078680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 256 - 352
Target Start/End: Original strand, 9292018 - 9292114
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||||||||||||||||||| | |||||| || |||||||||||||||| | |||||||||||||| ||||||||||||||||||| |
|
|
| T |
9292018 |
gtctagaagtcctagctcaactggcaaatgtcgaaattgtaaagccggacgttgtgacccgaattcgaactcgggacttcacagttgtgtgtgagtt |
9292114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 256 - 346
Target Start/End: Complemental strand, 10963368 - 10963278
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtg |
346 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| ||||| |||||||| ||||||||| | ||||||||| |||||||||||||||||||| |
|
|
| T |
10963368 |
gtctagaagtcctagctcaactggcaaatgccgaaattacaaggccgaacgttgtgatccaggttcgaacccgggacctcacagttgtgtg |
10963278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 274 - 352
Target Start/End: Original strand, 42885192 - 42885270
Alignment:
| Q |
274 |
aactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||| |||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
42885192 |
aactggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacccgggatctcacagttgtgtgtgagtt |
42885270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 267 - 352
Target Start/End: Original strand, 3822407 - 3822492
Alignment:
| Q |
267 |
ctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| |||||||||||||||| |||||| |||| |||||||||||||| |||||||||| | ||| |||||||||||||||||||| |
|
|
| T |
3822407 |
ctagttcaactggcaaatgccgaaattgtaaggtcggacgttgtgacccgggttcgaacccaggatctcacagttgtgtgtgagtt |
3822492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 256 - 342
Target Start/End: Complemental strand, 12534846 - 12534760
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttg |
342 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| ||||||||||||||||||| |||| | |||||||||| | ||| |||||||||| |
|
|
| T |
12534846 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcgtgatccgggttcgaacccaggatctcacagttg |
12534760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 255 - 352
Target Start/End: Complemental strand, 41849360 - 41849263
Alignment:
| Q |
255 |
tgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||||| || || |||||||||||||||| ||||||||||| ||||||| |||| ||||||||||| ||| ||||||| |||||||||||||| |
|
|
| T |
41849360 |
tgtctggaagtcttaattcaactggcaaatgccgaaattgcaaggtcggacgtcgtgatctgggttcgaatccggaacctcactgttgtgtgtgagtt |
41849263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 280 - 352
Target Start/End: Original strand, 5385362 - 5385434
Alignment:
| Q |
280 |
caaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||| |||||||||||| |||||| |||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5385362 |
caaatgccgaaattgcaaggctggacgtcgtgacccaggttcgaacccgggacctcacagttgtgtgtgagtt |
5385434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 253 - 352
Target Start/End: Original strand, 18386705 - 18386804
Alignment:
| Q |
253 |
attgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||| ||| | |||||||||||| ||||||| ||||||||||| |||| || |||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
18386705 |
attgtctagaagttctagctcaactgacaaatgctgaaattgcaaggtcggatgtcatgactcgggttcgaacccgggacctcacagttgtgtgtgagtt |
18386804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 255 - 352
Target Start/End: Complemental strand, 45264768 - 45264672
Alignment:
| Q |
255 |
tgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||| ||| ||||| ||||||||||||||||| |||||||| || || |||| ||||| |||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
45264768 |
tgtctagaagtcctaactcaactggcaaatgccgaaattgca-ggtcgaacgtcgtgactcgggttcgaacccgggacctcacagttttgtgtgagtt |
45264672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 289 - 352
Target Start/End: Complemental strand, 31532220 - 31532157
Alignment:
| Q |
289 |
aaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||||||||||||||||||||| || || |||| ||||||||||||||||||||||||| |
|
|
| T |
31532220 |
aaattgcaaggccggacgttgtgacccggatttgaaccggggacctcacagttgtgtgtgagtt |
31532157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 255 - 307
Target Start/End: Original strand, 29425356 - 29425408
Alignment:
| Q |
255 |
tgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgt |
307 |
Q |
| |
|
||||| ||| ||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29425356 |
tgtctagaagtcctagctcaattggcaaatgccaaaattgcaaggccggacgt |
29425408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 268 - 349
Target Start/End: Complemental strand, 31969836 - 31969755
Alignment:
| Q |
268 |
tagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtga |
349 |
Q |
| |
|
||||| || ||||||||||| ||||| ||||||| ||||| ||| | |||||||||| |||||||||| |||||||||||| |
|
|
| T |
31969836 |
tagcttaattggcaaatgccgaaatttcaaggccagacgtcatgatccgggttcgaacacgggacctcaaagttgtgtgtga |
31969755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 265 - 348
Target Start/End: Original strand, 18752350 - 18752433
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtg |
348 |
Q |
| |
|
|||||| ||||||| ||||| || |||||| |||| ||||||| |||| | |||||||||| ||| |||| ||||||||||||| |
|
|
| T |
18752350 |
tcctagttcaactgacaaataccgaaattgtaaggtcggacgtcgtgatcggggttcgaacccggaaccttacagttgtgtgtg |
18752433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 33731551 - 33731496
Alignment:
| Q |
297 |
aggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||| ||||| |||||| |||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
33731551 |
aggccagacgtcgtgacccgggttcaaactcgggacctcccagttgtgtgtgagtt |
33731496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 254 - 352
Target Start/End: Original strand, 6099570 - 6099668
Alignment:
| Q |
254 |
ttgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||| ||| |||||| |||||| ||||||| | ||||||||||||||||||| ||||| | |||||||| || |||||||| ||| | ||||||| |
|
|
| T |
6099570 |
ttgtctagaagtcctagttcaacttgcaaatgtcgaaattgcaaggccggacgtcatgacccgagttcgaacccgaaacctcacaattgcgcgtgagtt |
6099668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 312
Target Start/End: Original strand, 20269554 - 20269598
Alignment:
| Q |
268 |
tagctcaactggcaaatgccaaaattgcaaggccggacgttgtga |
312 |
Q |
| |
|
||||||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
20269554 |
tagctcaactggcaaataccgaaattgtaaggccggacgttgtga |
20269598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 312
Target Start/End: Original strand, 21056183 - 21056227
Alignment:
| Q |
268 |
tagctcaactggcaaatgccaaaattgcaaggccggacgttgtga |
312 |
Q |
| |
|
||||||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
21056183 |
tagctcaactggcaaataccgaaattgtaaggccggacgttgtga |
21056227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 267 - 352
Target Start/End: Original strand, 14400726 - 14400811
Alignment:
| Q |
267 |
ctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||||||| ||||| | |||||||| || ||||||| || | |||| || |||| |||||||||||| ||||| ||||||| |
|
|
| T |
14400726 |
ctagctcaactgacaaattctgaaattgcacggtcggacgtcgtaaactggatttgaacccgggacctcacaattgtgagtgagtt |
14400811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 265 - 325
Target Start/End: Complemental strand, 5700768 - 5700708
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaac |
325 |
Q |
| |
|
||||| ||||||||||||||||| |||||| |||||||| | | ||||| |||||||||| |
|
|
| T |
5700768 |
tcctaactcaactggcaaatgccgaaattgttaggccggatgctatgaccggggttcgaac |
5700708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 292 - 352
Target Start/End: Complemental strand, 9775134 - 9775074
Alignment:
| Q |
292 |
ttgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||||||| | | |||| |||||||||||| ||| ||||||||||| |||||||||| |
|
|
| T |
9775134 |
ttgcaaggccgaaaatcgtgatctgggttcgaacccggaacctcacagttatgtgtgagtt |
9775074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 77; Significance: 1e-35; HSPs: 22)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 256 - 352
Target Start/End: Original strand, 21018223 - 21018319
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
21018223 |
gtctagaagtcctagctcaactggcaaatgccaaaattgcgaggccggacgttgtgacccgggttcgaacccgggacctcacagttgtgtgtgagtt |
21018319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 255 - 352
Target Start/End: Complemental strand, 35317826 - 35317729
Alignment:
| Q |
255 |
tgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||| ||||||||||| |||||||| ||||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
35317826 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggtcggacgttatgacctggggtcgaacccgggacctcacagttgtgtgtgagtt |
35317729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 256 - 352
Target Start/End: Original strand, 13203957 - 13204053
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| ||||||||||||||||||| |||||| |||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
13203957 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcgtgacccgggttcgaacccgggacctcacagttatgtgtgagtt |
13204053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 265 - 352
Target Start/End: Complemental strand, 4825058 - 4824971
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
4825058 |
tcctagctcaactggcaaatgccgaaattgcaaggccggacgttgtgacccaggttcaaacccgggacctcacagttgtgtgtgagtt |
4824971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 254 - 352
Target Start/End: Complemental strand, 1191670 - 1191572
Alignment:
| Q |
254 |
ttgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||| | ||||||||||||||||||| |||| | |||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
1191670 |
ttgtctagaagtcctagctcaactggcaaatgacgaaattgcaaggccggacgtcgtgatccgggttcgaacccgggacctcacaattgtgtgtgagtt |
1191572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 256 - 352
Target Start/End: Original strand, 12257356 - 12257452
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| |||||| |||||| ||||||||||||||||||||||| | |||||||| | ||||||||||||| |
|
|
| T |
12257356 |
gtctagaagtcctagctcaactggcaaatgccgaaattgtaaggccagacgttgtgacctgggttcgaacccaggacctcataattgtgtgtgagtt |
12257452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 265 - 352
Target Start/End: Original strand, 6021001 - 6021088
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||| ||||| ||||||||| ||||||||||||||| |||||||||||| || ||||||| ||||||||| |||||||||||||||| |
|
|
| T |
6021001 |
tcctaactcaattggcaaatgtcaaaattgcaaggcctgacgttgtgacccggattcgaacccgggacctctcagttgtgtgtgagtt |
6021088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 265 - 352
Target Start/End: Original strand, 8734005 - 8734092
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| ||||||| ||||||||| ||| ||||||||||||| ||||||| |
|
|
| T |
8734005 |
tcctagctcaactggcaaatgctgaaattgcaaggccggacgtcgtgacctaggttcgaacccggaacctcacagttgtacgtgagtt |
8734092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 256 - 352
Target Start/End: Complemental strand, 9577089 - 9576993
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| |||||||||||||||||||||| ||||||||||||| ||||| |||||||||||||||| | | ||||||||||||| |||||||| |
|
|
| T |
9577089 |
gtctagaagtcctagctcaactggcaaatgctgaaattgcaaggccagacgtcatgacctgggttcgaacccagaacctcacagttgtatgtgagtt |
9576993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 255 - 349
Target Start/End: Original strand, 27721430 - 27721524
Alignment:
| Q |
255 |
tgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtga |
349 |
Q |
| |
|
||||| ||| ||||||||||||||| ||||||| ||||||||| | ||||||| |||||| ||||| |||| ||||||||||||||||| ||||| |
|
|
| T |
27721430 |
tgtctagaagtcctagctcaactggaaaatgccgaaattgcaaagtcggacgtcgtgacccgggtttgaacccgggacctcacagttgtatgtga |
27721524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 254 - 352
Target Start/End: Original strand, 40177622 - 40177720
Alignment:
| Q |
254 |
ttgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||| ||| |||||||| ||||| |||||| | ||||||||||||||||||||||||||||| ||| ||| ||| || |||| |||||||||||||| |
|
|
| T |
40177622 |
ttgtctagaagtcctagcttaactgacaaatgtcgaaattgcaaggccggacgttgtgacctggattccaacccggaacttcaccgttgtgtgtgagtt |
40177720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 251 - 314
Target Start/End: Complemental strand, 32143535 - 32143472
Alignment:
| Q |
251 |
taattgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacc |
314 |
Q |
| |
|
|||| |||| ||| || ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32143535 |
taatagtctagaagtcatagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacc |
32143472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 255 - 325
Target Start/End: Original strand, 11124651 - 11124721
Alignment:
| Q |
255 |
tgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaac |
325 |
Q |
| |
|
||||| ||| ||||||||||||||||||||| ||||||||||||||||||||| ||||||| | ||||||| |
|
|
| T |
11124651 |
tgtctagaagtcctagctcaactggcaaatgtcaaaattgcaaggccggacgtcgtgaccttgattcgaac |
11124721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 255 - 352
Target Start/End: Original strand, 2970983 - 2971080
Alignment:
| Q |
255 |
tgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||| ||| |||||||||||||| ||||| | |||||| |||| | |||||||||||| |||||||||| | ||||||||||||||||||||||| |
|
|
| T |
2970983 |
tgtctagaagtcctagctcaactgataaatgtcgaaattgtaaggtcagacgttgtgacccgggttcgaacctgagacctcacagttgtgtgtgagtt |
2971080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 289 - 352
Target Start/End: Complemental strand, 31909480 - 31909417
Alignment:
| Q |
289 |
aaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||||||||| ||||| ||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
31909480 |
aaattgcaaggccagacgtcatgacccgggttcgaacccgggacctcacagttgtgtgtgagtt |
31909417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 256 - 352
Target Start/End: Original strand, 29265875 - 29265971
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||| ||||||| | ||||| | ||||| ||||| || | ||||||||| || ||||||| |||||||||||||||||||||||||| |
|
|
| T |
29265875 |
gtctagaagtcctaactcaactagaaaatgtcgaaattacaaggtcgaatgttgtgacccggattcgaacccgggacctcacagttgtgtgtgagtt |
29265971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 265 - 344
Target Start/End: Complemental strand, 3049173 - 3049094
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtg |
344 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||||||||| |||||| | ||| ||| |||||||||||||||||| |
|
|
| T |
3049173 |
tcctagttcaactcacaaatgccaaaattgcaaggccggacgccgtgacccgatttcaaacccgggacctcacagttgtg |
3049094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 265 - 325
Target Start/End: Complemental strand, 3387019 - 3386959
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaac |
325 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||||| || | | |||||||||| |
|
|
| T |
3387019 |
tcctagttcaactggcaaatgccgaaattgcaaggccggacgtcgttatccgggttcgaac |
3386959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 256 - 352
Target Start/End: Original strand, 21112049 - 21112145
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| |||||||||| ||| |||||| | ||||||||||| | |||| ||||||| ||||||||| ||||||||| |||||||| |||||| |
|
|
| T |
21112049 |
gtctagaagtcctagctcagctgacaaatgtcgaaattgcaaggacatacgtcgtgacctaggttcgaacctgggacctcaaagttgtgtttgagtt |
21112145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 256 - 322
Target Start/End: Original strand, 30127894 - 30127960
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcg |
322 |
Q |
| |
|
|||| ||| ||||||||||||| | ||||||| ||||||||||||||||| | |||||| ||||||| |
|
|
| T |
30127894 |
gtctagaagtcctagctcaacttgtaaatgccgaaattgcaaggccggacatcgtgacccgggttcg |
30127960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 265 - 352
Target Start/End: Complemental strand, 17984861 - 17984774
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||||||||| ||| | | |||||||||| |||||| |||| |||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
17984861 |
tcctagctcaactgaaaaaggtcgaaattgcaagattggacgtcctgactcgggttcgaacccggaacctcacagttgtgtgtgagtt |
17984774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 265 - 352
Target Start/End: Complemental strand, 28591469 - 28591382
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||| || ||||||||||| | ||||||||||||||||||| ||||| |||||| ||| | ||||||||||||||| |||||| |
|
|
| T |
28591469 |
tcctaactaaactggcaaatactgaaattgcaaggccggacgtagtgactcgggttcaaacctgaaacctcacagttgtgtatgagtt |
28591382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 77; Significance: 1e-35; HSPs: 40)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 256 - 352
Target Start/End: Original strand, 45874055 - 45874151
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45874055 |
gtctagaagtcctagctcaactgacaaatgccaaaattgcaaggccggacgttgtgacccgggttcgaacccgggacctcacagttgtgtgtgagtt |
45874151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 255 - 352
Target Start/End: Original strand, 1173950 - 1174047
Alignment:
| Q |
255 |
tgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1173950 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacctgggttcgaacccgggacctcacagttgtgtgtgagtt |
1174047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 265 - 352
Target Start/End: Complemental strand, 23417602 - 23417515
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| | ||||||||||||||||| |
|
|
| T |
23417602 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacccgggttcgaacccgggactttacagttgtgtgtgagtt |
23417515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 256 - 352
Target Start/End: Complemental strand, 19849631 - 19849535
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| ||||||||||||||||||| |||| | |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
19849631 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcgtgatccgggttcgaacccgggacctcacagttgtgtgtgagtt |
19849535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 256 - 352
Target Start/End: Original strand, 34739280 - 34739376
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| ||||||||||||||||||| ||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
34739280 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacccgggacctcacagttgtgtgtgagtt |
34739376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 254 - 352
Target Start/End: Complemental strand, 28798518 - 28798420
Alignment:
| Q |
254 |
ttgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||| ||| |||||| |||||||||||||||| ||||||||||||||||||| |||||| |||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
28798518 |
ttgtctagaagtcctagttcaactggcaaatgccgaaattgcaaggccggacgtcgtgacccgggttcgaacccgggaccttacagttgtgtgtgagtt |
28798420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 267 - 352
Target Start/End: Complemental strand, 43140023 - 43139938
Alignment:
| Q |
267 |
ctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| ||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43140023 |
ctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacccgggacctcacagttgtgtgtgagtt |
43139938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 253 - 352
Target Start/End: Original strand, 53457821 - 53457920
Alignment:
| Q |
253 |
attgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||| ||||||||||| ||||||| ||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
53457821 |
attgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggtcggacgtcatgacccgggttcgaatccgggacctcacagttgtgtgtgagtt |
53457920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 238 - 352
Target Start/End: Complemental strand, 26425003 - 26424890
Alignment:
| Q |
238 |
taaatataaaatataattgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcac |
337 |
Q |
| |
|
||||||||||| || | |||| ||| ||||||||||||||||||||||| |||||||||||| |||||| ||||| |||||||||| ||||||||||| |
|
|
| T |
26425003 |
taaatataaaaaattagagtctagaagtcctagctcaactggcaaatgccgaaattgcaaggc-ggacgtcatgacccgggttcgaacccgggacctcac |
26424905 |
T |
 |
| Q |
338 |
agttgtgtgtgagtt |
352 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
26424904 |
agttgtgtgtgagtt |
26424890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 255 - 352
Target Start/End: Complemental strand, 238587 - 238490
Alignment:
| Q |
255 |
tgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||| ||| |||||||||||||| |||||||| |||||||||||| ||||| |||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
238587 |
tgtctagaagtcctagctcaactgtcaaatgccgaaattgcaaggctggacgccatgacctgggttcgaacccgggacctcacagttgtgtgtgagtt |
238490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 267 - 352
Target Start/End: Original strand, 12735442 - 12735527
Alignment:
| Q |
267 |
ctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||| |||||||||||| |||||||||| | |||||||||||||||||||||||| |
|
|
| T |
12735442 |
ctagctcaactgacaaatgccaaaattgtaaggccagacgttgtgacccgggttcgaacccaggacctcacagttgtgtgtgagtt |
12735527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 271 - 352
Target Start/End: Original strand, 55214667 - 55214748
Alignment:
| Q |
271 |
ctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |||||| |||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
55214667 |
ctcaactgtcaaatgccaaaattgcaaggccggacgtcgtgacccgggttcgaacccgggacctcacagttgtgtatgagtt |
55214748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 256 - 352
Target Start/End: Complemental strand, 54768560 - 54768464
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| ||||||||||||||||||| ||||| |||||||||| | |||||||||||||||||| ||||| |
|
|
| T |
54768560 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacccaggacctcacagttgtgtgcgagtt |
54768464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 255 - 352
Target Start/End: Original strand, 18257328 - 18257425
Alignment:
| Q |
255 |
tgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||| ||||||||||||||||||| ||| | |||||||| | |||||||||||||||||| ||||||| |
|
|
| T |
18257328 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgatccgggttcgagcccgggacctcacagttgtgcgtgagtt |
18257425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 251 - 352
Target Start/End: Complemental strand, 29581176 - 29581075
Alignment:
| Q |
251 |
taattgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgag |
350 |
Q |
| |
|
|||||||| ||| ||||||||||| || || ||||| ||||||||||||||||||| ||||||| ||||||||| || ||||||||||||||||||||| |
|
|
| T |
29581176 |
taattgtcaagaagtcctagctcaattgtcagatgccgaaattgcaaggccggacgtcgtgacctaggttcgaacccgagacctcacagttgtgtgtgag |
29581077 |
T |
 |
| Q |
351 |
tt |
352 |
Q |
| |
|
|| |
|
|
| T |
29581076 |
tt |
29581075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 265 - 352
Target Start/End: Original strand, 22607994 - 22608081
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||||||||| || ||| | ||||||||||||||||||| |||||| |||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
22607994 |
tcctagctcaactgacagatgtcgaaattgcaaggccggacgtcgtgacccgggttcgaacccgggacctcacagttgtgtctgagtt |
22608081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 255 - 344
Target Start/End: Original strand, 11277981 - 11278070
Alignment:
| Q |
255 |
tgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtg |
344 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||| ||||||||||||||||| | ||||| |||||| ||| |||||||||||||||||| |
|
|
| T |
11277981 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacatcatgacccgggttcaaacccgggacctcacagttgtg |
11278070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 251 - 352
Target Start/End: Complemental strand, 19674062 - 19673961
Alignment:
| Q |
251 |
taattgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgag |
350 |
Q |
| |
|
||||||||| ||| || |||||||||||| ||||| |||||||||||||| |||||||||||||||||||||| |||||||||||| || |||| ||| |
|
|
| T |
19674062 |
taattgtctagaagtcttagctcaactggtaaatgtagaaattgcaaggccgaacgttgtgacctgggttcgaacccgggacctcacaattatgtgcgag |
19673963 |
T |
 |
| Q |
351 |
tt |
352 |
Q |
| |
|
|| |
|
|
| T |
19673962 |
tt |
19673961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 265 - 346
Target Start/End: Original strand, 3465761 - 3465842
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtg |
346 |
Q |
| |
|
||||||||||||| |||||| | |||||||||||||||||||||||| | |||||||||||||||||||| ||||||||| |
|
|
| T |
3465761 |
tcctagctcaactagcaaatatcgaaattgcaaggccggacgttgtgatccaggttcgaactcgggacctcatagttgtgtg |
3465842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 251 - 352
Target Start/End: Original strand, 19814100 - 19814201
Alignment:
| Q |
251 |
taattgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgag |
350 |
Q |
| |
|
||||||| | ||| || ||||||||||||||||||| |||||| |||||||||||| ||||||||||||| ||| ||||||||||| || |||||||| |
|
|
| T |
19814100 |
taattgtttagaagtcttagctcaactggcaaatgcagaaattgtaaggccggacgtcgtgacctgggttcaaacctgggacctcacaattatgtgtgag |
19814199 |
T |
 |
| Q |
351 |
tt |
352 |
Q |
| |
|
|| |
|
|
| T |
19814200 |
tt |
19814201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 256 - 349
Target Start/End: Complemental strand, 32441212 - 32441119
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtga |
349 |
Q |
| |
|
|||| ||| ||||||||||||||||||||| | ||||||||||||| ||| | ||||| |||||||||| |||||||||||||||||| |||| |
|
|
| T |
32441212 |
gtctagaagtcctagctcaactggcaaatgtcgaaattgcaaggccagacatcatgacccgggttcgaacccgggacctcacagttgtgcgtga |
32441119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 265 - 352
Target Start/End: Original strand, 19225268 - 19225355
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||||||||||||||||||| |||||| || ||||||||| ||| | |||||||||| |||||||||||| ||||| ||||||| |
|
|
| T |
19225268 |
tcctagctcaactggcaaatgccgaaattgtaaagccggacgtcatgatccgggttcgaacccgggacctcacaattgtgcgtgagtt |
19225355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 352
Target Start/End: Original strand, 39807869 - 39807940
Alignment:
| Q |
281 |
aaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||| ||||||||||||| ||| | |||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39807869 |
aaatgccgaaattgcaaggccagacatcgtgacccgagttcgaactcgggacctcacagttgtgtgtgagtt |
39807940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 256 - 350
Target Start/End: Complemental strand, 2864876 - 2864782
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgag |
350 |
Q |
| |
|
|||| ||| ||||| ||||||||||||||||| |||||||||||| |||||| |||||| |||||||||| | |||||| ||||||||||||| |
|
|
| T |
2864876 |
gtctagaagtcctaactcaactggcaaatgcctaaattgcaaggcgggacgtcgtgacccgggttcgaacctagaacctcagagttgtgtgtgag |
2864782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 267 - 352
Target Start/End: Original strand, 12867852 - 12867937
Alignment:
| Q |
267 |
ctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| ||||||| |||||| | |||||||| |||| |||||||||||| ||||||| |
|
|
| T |
12867852 |
ctagctcaactgtcaaatgccgaaattgcaaggtcggacgtcgtgacccgagttcgaacctgggatctcacagttgtgagtgagtt |
12867937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 261 - 349
Target Start/End: Original strand, 23858483 - 23858571
Alignment:
| Q |
261 |
gaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtga |
349 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||| ||||||| | ||||||| | |||||||||||| |||||||| ||||||| |||| |
|
|
| T |
23858483 |
gaattcctagctcaactgacaaatgttaaaattgtaaggccgtaagttgtgatccgggttcgaactcaggacctcatagttgtgagtga |
23858571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 256 - 352
Target Start/End: Original strand, 55400228 - 55400324
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||| ||||||||| ||||||| ||||||||||||||||||| ||| | || ||||||||||| |||||| |||||| |||||||| |
|
|
| T |
55400228 |
gtctagaaatcctaactcaactggtaaatgccgaaattgcaaggccggacgtcatgatccggattcgaactcggaacctcatagttgtatgtgagtt |
55400324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 255 - 352
Target Start/End: Original strand, 12767086 - 12767183
Alignment:
| Q |
255 |
tgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||| ||| ||||||||||||||| ||||||| |||||| ||| ||||||| ||| ||||||||||| || |||||||||||||||||||||| |
|
|
| T |
12767086 |
tgtctagaagtcctagctcaactggtaaatgccgaaattgtaagatcggacgtcatgatctgggttcgaatccgaaacctcacagttgtgtgtgagtt |
12767183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 268 - 352
Target Start/End: Complemental strand, 23710449 - 23710365
Alignment:
| Q |
268 |
tagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||||||| ||||| | ||||||||||||||||||| |||||| || ||||||| || ||||||||||| ||||||||| |
|
|
| T |
23710449 |
tagctcaactggtaaatgtcgaaattgcaaggccggacgtcgtgacccggattcgaacctggaacctcacagttacgtgtgagtt |
23710365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 255 - 346
Target Start/End: Original strand, 32778124 - 32778215
Alignment:
| Q |
255 |
tgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtg |
346 |
Q |
| |
|
||||| ||| || ||| ||||||| ||||| |||||||||||||| ||||||| |||| | |||||||||| || ||||||||| ||||||| |
|
|
| T |
32778124 |
tgtctagaaatcatagatcaactgacaaataccaaaattgcaaggtcggacgtcgtgatccgggttcgaacacgagacctcacaattgtgtg |
32778215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 289 - 352
Target Start/End: Original strand, 2075538 - 2075601
Alignment:
| Q |
289 |
aaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||||||| ||||||| ||| ||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
2075538 |
aaattgcaagggcggacgtcatgatttgggttcgaacccgggacctcacagttatgtgtgagtt |
2075601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 270 - 345
Target Start/End: Complemental strand, 22910371 - 22910296
Alignment:
| Q |
270 |
gctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgt |
345 |
Q |
| |
|
||||||||| |||| | | ||||||||||| ||||||| |||||| |||||||||| |||| ||||||||||||| |
|
|
| T |
22910371 |
gctcaactgacaaaagtcgaaattgcaaggtcggacgtcgtgacccgggttcgaacctgggatctcacagttgtgt |
22910296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 270 - 345
Target Start/End: Original strand, 22968151 - 22968226
Alignment:
| Q |
270 |
gctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgt |
345 |
Q |
| |
|
||||||||| |||| | | ||||||||||| ||||||| |||||| |||||||||| |||| ||||||||||||| |
|
|
| T |
22968151 |
gctcaactgacaaaagtcgaaattgcaaggtcggacgtcgtgacccgggttcgaacctgggatctcacagttgtgt |
22968226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 277 - 352
Target Start/End: Complemental strand, 49030845 - 49030771
Alignment:
| Q |
277 |
tggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||||| | ||||||||||||||||||| |||| | | |||||||| ||| |||||| ||||||||||||||| |
|
|
| T |
49030845 |
tggcaaatgtcgaaattgcaaggccggacgtcgtgatccgagttcgaac-cggaacctcatagttgtgtgtgagtt |
49030771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 269 - 352
Target Start/End: Original strand, 51287614 - 51287697
Alignment:
| Q |
269 |
agctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||| ||| ||||||||||||||| |||| | ||||| |||| ||||||| ||| || |||||||||||||||||||||| |
|
|
| T |
51287614 |
agctcagctgacaaatgccaaaattgtaaggtcagacgtcgtgatctgggtttaaacccgaaacctcacagttgtgtgtgagtt |
51287697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 271 - 352
Target Start/End: Original strand, 50033396 - 50033478
Alignment:
| Q |
271 |
ctcaactggcaaatgccaaaattgcaaggcc-ggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||| |||||||| ||||||||| | | ||||||||||||| |||||||||| | ||| |||||||||||||| |||| |
|
|
| T |
50033396 |
ctcaactgtcaaatgccgaaattgcaaagactggacgttgtgacccgggttcgaacatgagacatcacagttgtgtgtaagtt |
50033478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 273 - 325
Target Start/End: Original strand, 2804539 - 2804591
Alignment:
| Q |
273 |
caactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaac |
325 |
Q |
| |
|
|||||| ||||||| ||||||| |||| |||||||||||||| |||||||||| |
|
|
| T |
2804539 |
caactgacaaatgctaaaattgtaaggtcggacgttgtgacccgggttcgaac |
2804591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 256 - 352
Target Start/End: Original strand, 37134048 - 37134144
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| |||||| ||||||||||||||| ||||| ||||| |||| || ||| | |||||||||| || || ||||||||||||||||||| |
|
|
| T |
37134048 |
gtctagaagtcctagttcaactggcaaatgctgaaattacaaggtcggatgtcatgatccgggttcgaacccgaaacttcacagttgtgtgtgagtt |
37134144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 265 - 325
Target Start/End: Complemental strand, 39284694 - 39284634
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaac |
325 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||||| || ||||| |||||||||| |
|
|
| T |
39284694 |
tcctagctcaactggcaaatgccgaaattgttaggccggatgtcatgaccggggttcgaac |
39284634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 317 - 352
Target Start/End: Original strand, 1966611 - 1966646
Alignment:
| Q |
317 |
ggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1966611 |
ggttcgaattcgggacctcacagttgtgtgtgagtt |
1966646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 77; Significance: 1e-35; HSPs: 37)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 256 - 352
Target Start/End: Original strand, 23839859 - 23839955
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23839859 |
gtctagaagtcctaactcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaacctgggacctcacagttgtgtgtgagtt |
23839955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 256 - 349
Target Start/End: Original strand, 26605624 - 26605717
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtga |
349 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
26605624 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgttgtgacccgggttcgaacccgggacctcacagttgtgtgtga |
26605717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 255 - 352
Target Start/End: Complemental strand, 45125294 - 45125197
Alignment:
| Q |
255 |
tgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||| |||||| |||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45125294 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgtaaggccggacgttgtgacttgggttcgaactcggaacctcacagttgtgtgtgagtt |
45125197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 238 - 352
Target Start/End: Complemental strand, 33083700 - 33083586
Alignment:
| Q |
238 |
taaatataaaatataattgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcac |
337 |
Q |
| |
|
|||| |||||||| | | |||| ||| ||||||||||||||||||||||| ||||||||||||||||||| ||||| |||||||||| ||||||||||| |
|
|
| T |
33083700 |
taaaaataaaataaattggtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacccgggacctcac |
33083601 |
T |
 |
| Q |
338 |
agttgtgtgtgagtt |
352 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
33083600 |
agttgtgtgtgagtt |
33083586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 255 - 352
Target Start/End: Complemental strand, 10639735 - 10639638
Alignment:
| Q |
255 |
tgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||| ||||||||||||||||||| ||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10639735 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacccgggacctcacagttgtgtgtgagtt |
10639638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 254 - 352
Target Start/End: Original strand, 34460367 - 34460465
Alignment:
| Q |
254 |
ttgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||| ||| |||||||||||||| |||||||| |||||||||||||||||||||||||| |||||||||| | | |||||||||||||||||||||| |
|
|
| T |
34460367 |
ttgtctagaagtcctagctcaactgacaaatgccgaaattgcaaggccggacgttgtgacccgggttcgaacccagaacctcacagttgtgtgtgagtt |
34460465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 255 - 348
Target Start/End: Original strand, 11708677 - 11708770
Alignment:
| Q |
255 |
tgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtg |
348 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||| |||||| ||||||||||||||||||| |||||||||| | |||||||||||||||||||| |
|
|
| T |
11708677 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgtaaggccggacgttgtgacccgggttcgaacccaggacctcacagttgtgtgtg |
11708770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 268 - 352
Target Start/End: Complemental strand, 37197726 - 37197642
Alignment:
| Q |
268 |
tagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||| |||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37197726 |
tagctcaactggcaaatgccgaaattgcaaggctggacgtcgtgacccgggttcgaacccgggacctcacagttgtgtgtgagtt |
37197642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 265 - 352
Target Start/End: Complemental strand, 11816670 - 11816583
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||| ||||||||||||||||| ||| ||||||||||||| |||||||| |
|
|
| T |
11816670 |
tcctagctcaactggcaaatgccgaaattgcaaggtcggacgtcgtgacctgggttcgaacccggaacctcacagttgtatgtgagtt |
11816583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 255 - 348
Target Start/End: Original strand, 11459714 - 11459807
Alignment:
| Q |
255 |
tgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtg |
348 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||| ||||||||||| ||||||| ||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
11459714 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggtcggacgtcatgacccgggttcgaacccgggacctcacagttgtgtgtg |
11459807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 255 - 348
Target Start/End: Original strand, 19537306 - 19537399
Alignment:
| Q |
255 |
tgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtg |
348 |
Q |
| |
|
||||| ||| |||||| |||||||||||||||| |||||||||||||||||||||||| | |||||||||| ||| |||||||||||||||||| |
|
|
| T |
19537306 |
tgtctagaagtcctagttcaactggcaaatgccgaaattgcaaggccggacgttgtgatccgggttcgaacccggaacctcacagttgtgtgtg |
19537399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 255 - 352
Target Start/End: Complemental strand, 29659347 - 29659250
Alignment:
| Q |
255 |
tgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||| ||||||| || |||||||| |||||||||| | ||||||||||||||||||||||| |
|
|
| T |
29659347 |
tgtctagaagtcctagctcaactggcaaatgccaaaattgtaaggccgaacattgtgacccgggttcgaacccatgacctcacagttgtgtgtgagtt |
29659250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 253 - 352
Target Start/End: Original strand, 19816217 - 19816316
Alignment:
| Q |
253 |
attgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||| ||| |||||||||||||||||||| || |||||||||||||||||||||||||| ||||| |||| ||| ||||| ||||||||| |||||| |
|
|
| T |
19816217 |
attgtctagaagtcctagctcaactggcaaataccgaaattgcaaggccggacgttgtgacccgggtttgaacccggaacctcgcagttgtgtatgagtt |
19816316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 256 - 352
Target Start/End: Original strand, 19048754 - 19048850
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| |||||| |||||||||||| ||| | |||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
19048754 |
gtctagaagtcctagctcaactggcaaatgccgaaattgtaaggccggacgtcatgatccgggttcgaacccgggacctcacaattgtgtgtgagtt |
19048850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 255 - 352
Target Start/End: Complemental strand, 39535663 - 39535566
Alignment:
| Q |
255 |
tgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||| ||| ||||| ||||||| ||||||| | ||||||||||||||||||| |||||| |||||||||| ||||||||||||||| | |||||||| |
|
|
| T |
39535663 |
tgtctagaagtcctaactcaactagcaaatgtcgaaattgcaaggccggacgtcgtgacccgggttcgaacccgggacctcacagttttatgtgagtt |
39535566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 253 - 352
Target Start/End: Original strand, 4851317 - 4851416
Alignment:
| Q |
253 |
attgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||| ||| |||||||||||||| ||| |||| |||||| || ||||||||| |||| | |||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
4851317 |
attgtcttgaagtcctagctcaactgtcaattgccgaaattgtaaagccggacgtcgtgatccgggttcaaacccgggacctcacagttgtgtgtgagtt |
4851416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 265 - 352
Target Start/End: Complemental strand, 39831562 - 39831476
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||| ||| | |||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
39831562 |
tcctagctcaactggcaaataccgaaattgcaaggccggacgtcatgatccgggttcgaac-cgggacctcacaattgtgtgtgagtt |
39831476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 265 - 335
Target Start/End: Complemental strand, 25501902 - 25501832
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctc |
335 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| ||||||| ||||||||| ||| ||||| |
|
|
| T |
25501902 |
tcctagctcaactggcaaatgctgaaattgcaaggccggacgtcgtgacctaggttcgaacccggaacctc |
25501832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 256 - 346
Target Start/End: Original strand, 34234530 - 34234620
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtg |
346 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| ||||||||||| |||| ||||||| ||| ||| |||| || ||||||| ||||||||| |
|
|
| T |
34234530 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggtcggatgttgtgatctgagtttgaacccgagacctcatagttgtgtg |
34234620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 265 - 352
Target Start/End: Original strand, 16654372 - 16654459
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||| |||||||| ||||||| |||||||||||||||||| |||| | | |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
16654372 |
tcctaactcaactgataaatgccgaaattgcaaggccggacgccgtgatccgagttcgaacccggaacctcacagttgtgtgtgagtt |
16654459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 267 - 346
Target Start/End: Original strand, 21312216 - 21312295
Alignment:
| Q |
267 |
ctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtg |
346 |
Q |
| |
|
||||||||| ||||||||| |||||||| ||| ||||||||||||| ||||| |||||| ||||||||||| ||||||| |
|
|
| T |
21312216 |
ctagctcaattggcaaatgtcaaaattgtaagaccggacgttgtgatctgggatcgaacctgggacctcacaattgtgtg |
21312295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 267 - 352
Target Start/End: Original strand, 4800887 - 4800972
Alignment:
| Q |
267 |
ctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||||| |||||||| | |||||||||||| |||||| |||||||| |||||||| ||| ||||| | ||| |||||||||| |
|
|
| T |
4800887 |
ctagctcaaccggcaaatgtcgaaattgcaaggctggacgtcgtgacctgagttcgaacccggaacctcgcggttatgtgtgagtt |
4800972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 255 - 347
Target Start/End: Complemental strand, 7276016 - 7275923
Alignment:
| Q |
255 |
tgtctggaattcctagctcaactggcaaa-tgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgt |
347 |
Q |
| |
|
||||| ||| ||||| |||||||| |||| |||| ||||||||||| |||| || ||| || |||||||||| ||||||||||||||||||||| |
|
|
| T |
7276016 |
tgtctagaagtcctaactcaactgacaaaatgccgaaattgcaaggtcggatgtcgtggcccgggttcgaacccgggacctcacagttgtgtgt |
7275923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 256 - 352
Target Start/End: Complemental strand, 27138045 - 27137950
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| |||||||||||||| ||||||| |||||| ||||||| || | ||||||||||||||||| |||||||| |||||| | |||||||| |
|
|
| T |
27138045 |
gtctagaagtcctagctcaactgacaaatgctgaaattg-aaggccgaacatcgtgacctgggttcgaacccgggaccttacagttttatgtgagtt |
27137950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 256 - 352
Target Start/End: Complemental strand, 45202000 - 45201904
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||| ||||| ||||||||| | |||||| |||| ||| ||| |||| | | |||||||||||| |||||||||||||||||||||| |
|
|
| T |
45202000 |
gtctagaagtcctaactcaattggcaaatgtcgaaattgtaaggtcggtcgtcgtgatccgagttcgaactcggaacctcacagttgtgtgtgagtt |
45201904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 265 - 352
Target Start/End: Original strand, 43684078 - 43684165
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||| |||||||| |||||||| ||||||||||||||||| |||| ||||||||||| ||||||| |||| || |||||||||| |
|
|
| T |
43684078 |
tcctatctcaactgacaaatgccgaaattgcaaggccggacaccatgacatgggttcgaacccgggaccccacaattatgtgtgagtt |
43684165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 265 - 351
Target Start/End: Original strand, 42025679 - 42025765
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagt |
351 |
Q |
| |
|
|||||||||||||| |||||| | ||||| ||||||||| || |||||||| |||||||| | | |||||||| |||||||||||| |
|
|
| T |
42025679 |
tcctagctcaactgacaaatgtcgaaattttaaggccggatgtcgtgacctgagttcgaacccagaacctcacaattgtgtgtgagt |
42025765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 271 - 352
Target Start/End: Complemental strand, 40786322 - 40786241
Alignment:
| Q |
271 |
ctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||| |||||| ||||||||| |||||| |||||| ||||||||| |
|
|
| T |
40786322 |
ctcaactgacaaatgccgaaattgcaaggccggacgtcgtgaccctggttcgaacctaagacctcgcagttgagtgtgagtt |
40786241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 265 - 352
Target Start/End: Complemental strand, 6055124 - 6055037
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||||||| || |||||||||||||||||||| || |||| || | || ||||||||| |||||||| || |||||||||||| |
|
|
| T |
6055124 |
tcctagctcaattgacaaatgccaaaattgcaaggtcgaacgtcgtaattcggattcgaactcaggacctcatagctgtgtgtgagtt |
6055037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 307
Target Start/End: Original strand, 42578180 - 42578231
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgt |
307 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
42578180 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggtcggacgt |
42578231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 314
Target Start/End: Complemental strand, 38440312 - 38440267
Alignment:
| Q |
269 |
agctcaactggcaaatgccaaaattgcaaggccggacgttgtgacc |
314 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||| |||||| |
|
|
| T |
38440312 |
agctcaactgacaaatgccgaaattgcaaggccggacgtcgtgacc |
38440267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 271 - 352
Target Start/End: Complemental strand, 43778581 - 43778500
Alignment:
| Q |
271 |
ctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||| ||||| || ||||||||| |||| | || ||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
43778581 |
ctcaactgacaaataccgaaattgcaaagccgaatgtcgtgacctgggttcgaacctaagacttcacagttgtgtgtgagtt |
43778500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 265 - 340
Target Start/End: Original strand, 15782599 - 15782674
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagt |
340 |
Q |
| |
|
||||||||||| || |||||||| |||||| |||| ||||||| ||||| |||||||||| || ||||| ||||| |
|
|
| T |
15782599 |
tcctagctcaattgacaaatgccgaaattgtaaggtcggacgtcatgacccgggttcgaacccgagaccttacagt |
15782674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 272 - 307
Target Start/End: Complemental strand, 32844689 - 32844654
Alignment:
| Q |
272 |
tcaactggcaaatgccaaaattgcaaggccggacgt |
307 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32844689 |
tcaactggcaaatgccgaaattgcaaggccggacgt |
32844654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 265 - 352
Target Start/End: Original strand, 33001712 - 33001798
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||| ||||||||||||||| |||||| ||| | | |||||||||| ||||||||||| | ||||||||||||| | |||||||| |
|
|
| T |
33001712 |
tcctaactcaactggcaaatgttgaaattgtaagactgaacgttgtgac-tgggttcgaacacaggacctcacagttatatgtgagtt |
33001798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 271 - 352
Target Start/End: Original strand, 7349113 - 7349194
Alignment:
| Q |
271 |
ctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||| |||| | | ||||||| || ||||||||| | |||||||||| |
|
|
| T |
7349113 |
ctcaactggcaaatgctgatattgcaaggccggacgtcgtgatccgagttcgaatccgagacctcacaactatgtgtgagtt |
7349194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 271 - 352
Target Start/End: Original strand, 12366743 - 12366824
Alignment:
| Q |
271 |
ctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||| |||| ||||||||| |||| | ||| |||||| | || ||| ||| ||| |||||||||||||||||||||| |
|
|
| T |
12366743 |
ctcaactgataaataccaaaattgtaaggtcagacattgtgatccggattcaaacccggaacctcacagttgtgtgtgagtt |
12366824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0032 (Bit Score: 73; Significance: 3e-33; HSPs: 1)
Name: scaffold0032
Description:
Target: scaffold0032; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 256 - 352
Target Start/End: Original strand, 56481 - 56577
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| ||||||||||| |||||||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
56481 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggtcggacgttgtgacccgggttcgaacccgggacctcacagttgtgtgtgagtt |
56577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 71; Significance: 4e-32; HSPs: 26)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 254 - 352
Target Start/End: Original strand, 33621492 - 33621590
Alignment:
| Q |
254 |
ttgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||| ||||||||||||||||||| ||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33621492 |
ttgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacccgggacctcacagttgtgtgtgagtt |
33621590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 256 - 352
Target Start/End: Original strand, 33704216 - 33704312
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| ||||||||||||||||||| ||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33704216 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacccgggacctcacagttgtgtgtgagtt |
33704312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 256 - 348
Target Start/End: Original strand, 21000692 - 21000784
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtg |
348 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| |||||||||||||| |||| |||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
21000692 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgtacgtcatgacctgggttcgaacccgggacctcacaattgtgtgtg |
21000784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 267 - 352
Target Start/End: Original strand, 21037302 - 21037386
Alignment:
| Q |
267 |
ctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| ||||||||| || |||||||||||||||||||||||| |
|
|
| T |
21037302 |
ctagctcaactggcaaatgctgaaattgcaaggccggacgttgtgactcgggttcgaa-tccggacctcacagttgtgtgtgagtt |
21037386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 256 - 352
Target Start/End: Original strand, 28322932 - 28323028
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| |||||| |||||||||||| ||| | |||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
28322932 |
gtctagaagtcctagctcaactggcaaatgccgaaattgtaaggccggacgtcatgatccgggttcgaacccgggacctcacaattgtgtgtgagtt |
28323028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 256 - 352
Target Start/End: Original strand, 11572008 - 11572104
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||||||||||| ||||||| |||||| |||||| ||||| |||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
11572008 |
gtctagaagtcctagctcaactaacaaatgcagaaattgtaaggccagacgtcgtgacccgggttcgaacccgggacctcacagttgtgtgtgagtt |
11572104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 256 - 314
Target Start/End: Complemental strand, 35218756 - 35218698
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacc |
314 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35218756 |
gtctagaagtcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacc |
35218698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 255 - 352
Target Start/End: Original strand, 2959148 - 2959245
Alignment:
| Q |
255 |
tgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||| ||| ||||| ||||||| ||||||||| |||||||||||||||| | ||||| | ||||||||| || ||||||||||||||||||||||| |
|
|
| T |
2959148 |
tgtctagaagtcctaactcaactagcaaatgccgaaattgcaaggccggatatcgtgacttaggttcgaacccgagacctcacagttgtgtgtgagtt |
2959245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 267 - 352
Target Start/End: Original strand, 4464138 - 4464223
Alignment:
| Q |
267 |
ctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||||||| |||||||| ||||||||||||||||||| ||| | |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4464138 |
ctagttcaactgacaaatgccgaaattgcaaggccggacgtcatgatccgggttcgaacctgggacctcacagttgtgtgtgagtt |
4464223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 281 - 346
Target Start/End: Original strand, 16518448 - 16518513
Alignment:
| Q |
281 |
aaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtg |
346 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| | ||| |||||||||||||| |
|
|
| T |
16518448 |
aaatgccaaaattgcaaggtcggacgttgtgacctgggttcgaacccaggagctcacagttgtgtg |
16518513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 265 - 346
Target Start/End: Original strand, 33255498 - 33255578
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtg |
346 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||| ||||||| ||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
33255498 |
tcctagctcagctggcaaatgccaaaattgtaaggctggacgtt-tgacctgagttcgaacctgggacctcacagttgtgtg |
33255578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 255 - 352
Target Start/End: Original strand, 361010 - 361107
Alignment:
| Q |
255 |
tgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||| ||| || ||||||| ||||||||||||||||||||||||||| || | ||||| |||||||||| ||| ||||||||||| | |||||||| |
|
|
| T |
361010 |
tgtctagaagtcttagctcatctggcaaatgccaaaattgcaaggccgaacatcgtgacacgggttcgaacccggaacctcacagttatatgtgagtt |
361107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 256 - 352
Target Start/End: Original strand, 12252023 - 12252119
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| |||||||||||||| ||||| || | |||||||| ||||| || |||||| ||||| |||| || ||||||| ||||||||||||||| |
|
|
| T |
12252023 |
gtctagaagtcctagctcaactgacaaataccgagattgcaagaccggatgtcgtgaccagggtttgaacccgagacctcatagttgtgtgtgagtt |
12252119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 273 - 352
Target Start/End: Original strand, 32289363 - 32289441
Alignment:
| Q |
273 |
caactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||||||||||| |||||||||| ||||| ||||||| | | |||||||||| |||||||||||||||||| |||| |
|
|
| T |
32289363 |
caactggcaaatgccgaaattgcaag-ccggatgttgtgatccgaattcgaactcgagacctcacagttgtgtgtaagtt |
32289441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 265 - 352
Target Start/End: Complemental strand, 32354059 - 32353973
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||| ||||| || |||||||||||||| |||| ||||||||||||| || |||||||| ||||| ||||||||||||||||||| |
|
|
| T |
32354059 |
tcctaactcaattgacaaatgccaaaattcaaaggtcggacgttgtgactcggattcgaact-gggacttcacagttgtgtgtgagtt |
32353973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 270 - 352
Target Start/End: Complemental strand, 584897 - 584816
Alignment:
| Q |
270 |
gctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||| ||||||||| |||||||||||| |||||| |||||| || |||||| ||||||||||||| || | |||||||| |
|
|
| T |
584897 |
gctcaactagcaaatgccgaaattgcaaggc-ggacgtcgtgacccggattcgaattcgggacctcacaattttatgtgagtt |
584816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 256 - 352
Target Start/End: Complemental strand, 24619207 - 24619111
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||| |||||||| |||||| |||||||| ||||||| |||| |||||| | |||||| | || ||||||| | ||||||||||||| |
|
|
| T |
24619207 |
gtctagaagtcctaactcaactgacaaatgtcaaaattgtaaggccgaacgtcgtgacccgagttcgatcccgtgacctcataattgtgtgtgagtt |
24619111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 256 - 336
Target Start/End: Complemental strand, 10226620 - 10226540
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctca |
336 |
Q |
| |
|
|||| ||| |||||||||||||||||||| || ||||| ||| || |||| | ||||| |||||||||| |||||||||| |
|
|
| T |
10226620 |
gtctagaagtcctagctcaactggcaaattccgaaattacaaagctggacttcgtgacacgggttcgaacccgggacctca |
10226540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 254 - 314
Target Start/End: Complemental strand, 28592246 - 28592186
Alignment:
| Q |
254 |
ttgtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacc |
314 |
Q |
| |
|
|||||| ||| |||||||| |||||||||||||| ||||| ||||| ||||||||||||| |
|
|
| T |
28592246 |
ttgtctagaagtcctagcttaactggcaaatgccgaaattataaggctggacgttgtgacc |
28592186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 269 - 352
Target Start/End: Original strand, 14495642 - 14495725
Alignment:
| Q |
269 |
agctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||||| |||||||| |||||||||| | | ||||||| | ||| |||| |||||| ||| |||||||||||||||||| |
|
|
| T |
14495642 |
agctcaactaacaaatgccgaaattgcaagactgaacgttgtaatctgagttcaaactcgagactacacagttgtgtgtgagtt |
14495725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 274 - 349
Target Start/End: Original strand, 19145489 - 19145563
Alignment:
| Q |
274 |
aactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtga |
349 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||| |||||| | || |||| |||||||||||| |||||||||| |
|
|
| T |
19145489 |
aactagcaaatgctgaaattgcaaggccggacgtcgtgacc-cgttttgaacccgggacctcacaattgtgtgtga |
19145563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 265 - 352
Target Start/End: Complemental strand, 29009769 - 29009682
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||| ||||| | ||||||| || ||| |||||||||||| ||||| | ||||||| ||||||||||||||||||||||||| |
|
|
| T |
29009769 |
tcctagttcaacggacaaatgctgaagttgtaaggccggacgtcatgacccgaattcgaacctgggacctcacagttgtgtgtgagtt |
29009682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 303 - 352
Target Start/End: Complemental strand, 17590443 - 17590394
Alignment:
| Q |
303 |
gacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||||||| |||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
17590443 |
gacgttgtgactcgggttcgaacccggagcctcacagttgtgtgtgagtt |
17590394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 268 - 312
Target Start/End: Complemental strand, 5598891 - 5598847
Alignment:
| Q |
268 |
tagctcaactggcaaatgccaaaattgcaaggccggacgttgtga |
312 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||| ||||| |||| |
|
|
| T |
5598891 |
tagctcaactgacaaatgtcaaaattgcaaggccagacgtcgtga |
5598847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 265 - 341
Target Start/End: Complemental strand, 7197925 - 7197849
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagtt |
341 |
Q |
| |
|
||||||||||| || ||||||||||||||| || | |||||| ||||| | |||||||| |||||||| |||||| |
|
|
| T |
7197925 |
tcctagctcaattgacaaatgccaaaattgtaaagttggacgtcttgacccgagttcgaacccgggaccttacagtt |
7197849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 254 - 298
Target Start/End: Original strand, 14939146 - 14939190
Alignment:
| Q |
254 |
ttgtctggaattcctagctcaactggcaaatgccaaaattgcaag |
298 |
Q |
| |
|
|||||| ||| ||||| ||||||||||||||||| |||||||||| |
|
|
| T |
14939146 |
ttgtctagaagtcctaactcaactggcaaatgccgaaattgcaag |
14939190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1348 (Bit Score: 69; Significance: 7e-31; HSPs: 1)
Name: scaffold1348
Description:
Target: scaffold1348; HSP #1
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 256 - 352
Target Start/End: Complemental strand, 990 - 894
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| ||||||||||||||||||| ||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
990 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacccgggacctcacagttgtgtgtgagtt |
894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 69; Significance: 7e-31; HSPs: 2)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 256 - 352
Target Start/End: Complemental strand, 14079 - 13983
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| |||||||||||||||||||| || |||||||||||||||||||||||| | |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14079 |
gtctagaagtcctagctcaactggcaaataccgaaattgcaaggccggacgttgtgatccgggttcgaacccgggacctcacagttgtgtgtgagtt |
13983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119; HSP #2
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 256 - 352
Target Start/End: Complemental strand, 19759 - 19663
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| |||||||||||||||||||| || |||||||||||||||||||||||| | |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
19759 |
gtctagaagtcctagctcaactggcaaataccgaaattgcaaggccggacgttgtgatccgggttcgaacccgggacctcacagttgtgtgtgagtt |
19663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0044 (Bit Score: 65; Significance: 2e-28; HSPs: 1)
Name: scaffold0044
Description:
Target: scaffold0044; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 256 - 352
Target Start/End: Complemental strand, 10101 - 10005
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| ||||||||||||||||||| || ||| |||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
10101 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcgtaacccgggttcgaacccgggacctcatagttgtgtgtgagtt |
10005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 57; Significance: 9e-24; HSPs: 1)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 256 - 352
Target Start/End: Original strand, 114252 - 114348
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| |||||| |||||||||||| ||| | |||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
114252 |
gtctagaagtcctagctcaactggcaaatgccgaaattgtaaggccggacgtcatgatccgggttcgaacccgggacctcacaattgtgtgtgagtt |
114348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0067 (Bit Score: 56; Significance: 4e-23; HSPs: 1)
Name: scaffold0067
Description:
Target: scaffold0067; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 265 - 352
Target Start/End: Original strand, 34827 - 34914
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| ||||| |||||||||| | ||||||| ||||||| |||||||| |
|
|
| T |
34827 |
tcctagctcaactggcaaatgccgaaattgcaaggccggacgtcgtgacatgggttcgaatccaggacctcgcagttgtatgtgagtt |
34914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0053 (Bit Score: 54; Significance: 6e-22; HSPs: 1)
Name: scaffold0053
Description:
Target: scaffold0053; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 267 - 352
Target Start/End: Original strand, 22174 - 22259
Alignment:
| Q |
267 |
ctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
|||||||||||| |||||||| |||||| |||||||||||| |||||| |||||||| | |||||||||||||||| ||||||||| |
|
|
| T |
22174 |
ctagctcaactgacaaatgccgaaattgtaaggccggacgtcgtgacccgggttcgagcccgggacctcacagttgcgtgtgagtt |
22259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0352 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: scaffold0352
Description:
Target: scaffold0352; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 267 - 352
Target Start/End: Complemental strand, 9060 - 8975
Alignment:
| Q |
267 |
ctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacagttgtgtgtgagtt |
352 |
Q |
| |
|
||||||||||||| ||||||| |||||| ||||| ||||||| ||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
9060 |
ctagctcaactggtaaatgccgaaattgtaaggcgggacgttatgattcgggttcgaacctaggacctcacagttgtgtgtgagtt |
8975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0360 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: scaffold0360
Description:
Target: scaffold0360; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 265 - 339
Target Start/End: Original strand, 14504 - 14578
Alignment:
| Q |
265 |
tcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctcacag |
339 |
Q |
| |
|
||||||| || ||| |||||| | ||||||||||||||||||| |||| | |||||||||| ||||||||||||| |
|
|
| T |
14504 |
tcctagcacagctgacaaatgtcgaaattgcaaggccggacgtcgtgatccgggttcgaacccgggacctcacag |
14578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0495 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0495
Description:
Target: scaffold0495; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 256 - 336
Target Start/End: Complemental strand, 3339 - 3259
Alignment:
| Q |
256 |
gtctggaattcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaactcgggacctca |
336 |
Q |
| |
|
|||| ||| |||||||||||||||||||| || ||||| ||| || |||| | ||||| |||||||||| |||||||||| |
|
|
| T |
3339 |
gtctagaagtcctagctcaactggcaaattccgaaattacaaagctggacttcgtgacacgggttcgaacccgggacctca |
3259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University