View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15081_high_30 (Length: 333)
Name: NF15081_high_30
Description: NF15081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15081_high_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 3e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 20 - 163
Target Start/End: Complemental strand, 45774423 - 45774280
Alignment:
| Q |
20 |
cgatacacttggcatatgatttacgtaatttgtaaccccccgatacactcagtgctcgcccttccatcaatcatcagacccaaccattgaaggatgccgt |
119 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45774423 |
cgatacacttggcatatgatttaggtaatttgtaaccccccgatacactcagtgctcgcccttccatcaatcatcagacccaaccattgaaggatgccgt |
45774324 |
T |
 |
| Q |
120 |
ttgtaatggatgcaaggttagagcgttcgcaggtaccaccctta |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45774323 |
ttgtaatggatgcaaggttagagcgttcgcaggtaccaccctta |
45774280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 99; E-Value: 8e-49
Query Start/End: Original strand, 218 - 324
Target Start/End: Complemental strand, 45774276 - 45774170
Alignment:
| Q |
218 |
gaatattgttttactaattttttactactcaatgtacattaaaacattattatacaatttagtagtactaaaagaaatagaatgaaagagaacaaaacaa |
317 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45774276 |
gaatattgttttactaatttttgactactcaatgtacattaaaacattattatacaatttagtagtactaaaagaaatagattgaaagagaacaaaacaa |
45774177 |
T |
 |
| Q |
318 |
gaataat |
324 |
Q |
| |
|
||||||| |
|
|
| T |
45774176 |
gaataat |
45774170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University