View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15081_high_31 (Length: 331)
Name: NF15081_high_31
Description: NF15081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15081_high_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 1 - 313
Target Start/End: Complemental strand, 31669220 - 31668908
Alignment:
| Q |
1 |
gtgtgatacatgctaacatatttaattaattagcatgaaacatgatatgaactatgataatttacagactatgatcttagttttcccgatgatcactatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
31669220 |
gtgtgatacatgctaacatatttaattaattagcatgaaacatgatatgaaccatgataatttacaaactatgatcttagttttcccaatgatcactatt |
31669121 |
T |
 |
| Q |
101 |
acccttaaataggtggagctca-ttgagatactacgtctcaccccaatccctttttattttattacatatacagaggtgaggtgactaaggcttgtgaca |
199 |
Q |
| |
|
|||||| | ||||||||||||| |||||||| ||||||||| ||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
31669120 |
acccttga-taggtggagctcacttgagatattacgtctcatcccaatccctttttattttattacagatacacaggtgaggtgactaaggcttgtgaca |
31669022 |
T |
 |
| Q |
200 |
agggtaaggagaaaacaactgaatgattatgctgacgtgtttcatttattagtttatgtactagttgccgtgatgttatacactgactatgttcttgttt |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31669021 |
agggtaaggagaaaacaactgaatgattatgctgacgtgtttcatttattagtttatgtactagttgccgtgatgttatacactgactatgttcttgttt |
31668922 |
T |
 |
| Q |
300 |
atgatgtactcatt |
313 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
31668921 |
atgatgtactcatt |
31668908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University