View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15081_low_17 (Length: 451)
Name: NF15081_low_17
Description: NF15081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15081_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 357; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 357; E-Value: 0
Query Start/End: Original strand, 10 - 434
Target Start/End: Original strand, 52609021 - 52609439
Alignment:
| Q |
10 |
attattcttaagatccaatctcagacatggttggaagaaaaggccgaagtggatgctaggaagttgatgtggttgttgacgacagcggttcttcatgggt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52609021 |
attattcttaagatccaatctcagacatagttggaagaaacggccgaagtgggtgctaggaagttgatgtggttgttgacgacagcggttcttcatgggt |
52609120 |
T |
|
| Q |
110 |
gtgggggatgtaccaacaaagacattccaatactcaaagtcaatgatatctcaaggtattttaaggcttttctcgaaatgagaatgtgcacatgattttg |
209 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52609121 |
gtggg--atgtaccaacaaagacattccaatactcaaagtcaatgatatctcaaggtgttttaaggcttttctcgaaatgagaatgtgcacatgattttg |
52609218 |
T |
|
| Q |
210 |
cagtggtttattctatttttagattaattttcagttcgttcgttgcattagtacgggcttttagacggctgcacactattgcctctgagagccttattta |
309 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52609219 |
cagtggattattctatttttagatt----ttcagttcgttcgttgcattagtacgtgcttttagacggctgcacactattgcctctgagagccttattta |
52609314 |
T |
|
| Q |
310 |
gtgtttcacggctctttacatatataagagatccacgactgcatttccgcacctcattttaccttagcccacaagtcattgtcttgttctttgaggcgaa |
409 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
52609315 |
gtgtttcacggctctttacatatataagagatccacgactgcattttcgcgcctcattttaccctagcccccaagtcattgtcttgttctttgaggcgaa |
52609414 |
T |
|
| Q |
410 |
gacttaaagattctagtgctctaac |
434 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
52609415 |
gacttaaagattctagtgctctaac |
52609439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University