View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15081_low_25 (Length: 374)
Name: NF15081_low_25
Description: NF15081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15081_low_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 36 - 358
Target Start/End: Complemental strand, 46413426 - 46413100
Alignment:
| Q |
36 |
tttaaagtcctaatcaattttcagttattcccctgatcagattatttgga----ggcatttgaagtagttgaccatgtcagacgaaaaagatgatgtaat |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46413426 |
tttaaagtcctaatcaattttcagttattcccctgatcagattatttggacacagccatttgaagtagttgaccatgtcagacgaaaaagatgatgtaat |
46413327 |
T |
|
| Q |
132 |
caagtggtacttgcctttccagcagagtaaattctttggcaaagagacagggttggacaagaaaggaagggaagatagtggagtaagagttgtgtaaaaa |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
46413326 |
caagtggtacttgcctttccagcagagtaaattctttggcaaagagacagggttggacaagaaaggaagggatggcagtggagtaagagttgtgtaaaaa |
46413227 |
T |
|
| Q |
232 |
tgtgaaagtaataggagatagcgtgatgagaatgggaggttctaagcagcaagtaagcaaaggaaaacagcacttgaagtggaagnnnnnnngccttaga |
331 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
46413226 |
tgtgaaagtaataggagatagcgtgaggagaatgggaggttctaagcagcaagtaagcaaaggaaaacagcacttgaagtggaagtttttttgccttaga |
46413127 |
T |
|
| Q |
332 |
aagtgggggattctctgctctgctctg |
358 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
46413126 |
aagtgggggattctctgctctgctctg |
46413100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University