View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15081_low_43 (Length: 255)

Name: NF15081_low_43
Description: NF15081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15081_low_43
NF15081_low_43
[»] chr3 (1 HSPs)
chr3 (184-255)||(48714753-48714824)


Alignment Details
Target: chr3 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 184 - 255
Target Start/End: Complemental strand, 48714824 - 48714753
Alignment:
184 atagataataaagatgacaaaatacggatgattcaattagaatacataatcattaaatttgtgatgaacagc 255  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48714824 atagataataaagatgacaaaatacggatgattcaattagaatacataatcattaaatttgtgatgaacagc 48714753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University