View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15081_low_44 (Length: 254)
Name: NF15081_low_44
Description: NF15081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15081_low_44 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 11 - 233
Target Start/End: Original strand, 35223818 - 35224040
Alignment:
| Q |
11 |
caaaggtgtacttgctagcactctaaggttcaagctagcgtttgatagagatgagtgagatgtatcagaatgaaagtgtaccttactaccttaggttgaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35223818 |
caaaggtgtacttgctagcactctaaggttcaagctagcgtttgatagagatgagtgagatgtatcaggatgaaagtgtaccttactaccttaggttgaa |
35223917 |
T |
 |
| Q |
111 |
agggtgaccccttatacaaggctctaagccccatcaaaagcaataatcactttttcttaagggtgacagtgacaattggacagttgtaattgcataactg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35223918 |
agggtgaccccttatacaaggctctaagccccatcaaaagcaataatcactttttcttaagggtgacagtgacaattggacagttgtaattgcataactg |
35224017 |
T |
 |
| Q |
211 |
tctttcagttgttcgttagagtc |
233 |
Q |
| |
|
|||||||||||||||| |||||| |
|
|
| T |
35224018 |
tctttcagttgttcgtcagagtc |
35224040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University