View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15081_low_53 (Length: 238)
Name: NF15081_low_53
Description: NF15081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15081_low_53 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 15 - 222
Target Start/End: Original strand, 32550558 - 32550765
Alignment:
| Q |
15 |
ataggaagcttgttgagaggctcttttccaaggagcatcagttgatcatggtttgaccctccgaacttggaccaatgttgccggcgataaatctaaaggg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32550558 |
ataggaagcttgttgagaggctcttttccaaggagcatcagttgatcatggtttgaccctccaaacttggactaatgttgccggcgataaatctaaaggg |
32550657 |
T |
 |
| Q |
115 |
aagttatatggagctggtaacttagctgtcaactaccagaagggaattgcacatccctcaagctcaccctgaatcatggtgaggggtcctcacaccagcc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32550658 |
aagttatatggagctggtaacttagctgtcaaccaccagaagggaattgcacatccctcaagctcaccctgaatcatggtgagggatcctcacaccagcc |
32550757 |
T |
 |
| Q |
215 |
tgagatga |
222 |
Q |
| |
|
|||||||| |
|
|
| T |
32550758 |
tgagatga |
32550765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 55 - 216
Target Start/End: Complemental strand, 7781952 - 7781790
Alignment:
| Q |
55 |
gttgatcatggtttgaccctccgaacttggaccaatgttgccggcgataaatctaaagggaagttatatggagctggtaacttagctgtcaactaccaga |
154 |
Q |
| |
|
||||||||| ||||| |||||| | | |||||||| ||||| ||||||||| | ||||| || |||||||| || |||||||| || | ||||||| || |
|
|
| T |
7781952 |
gttgatcatagtttggccctccaaccatggaccaaagttgctggcgataaaaccaaaggaaaattatatggtgccggtaacttggccgctaactacctga |
7781853 |
T |
 |
| Q |
155 |
agggaattgca-catccctcaagctcaccctgaatcatggtgaggggtcctcacaccagcctg |
216 |
Q |
| |
|
|||| ||||| || |||||| | ||||| ||||||||||| || ||||| || ||||||| |
|
|
| T |
7781852 |
agggtgttgcaacaaccctcagatttacccttaatcatggtgaaggatcctcccagcagcctg |
7781790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University