View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15081_low_58 (Length: 219)
Name: NF15081_low_58
Description: NF15081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15081_low_58 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 20 - 204
Target Start/End: Original strand, 35060208 - 35060404
Alignment:
| Q |
20 |
agctaaactctggattgaacccgccacagtgtttgatattctctattactactttcatggttatagtaaccatatcaataacc------------aaaac |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35060208 |
agctaaactctggattgaacccgccacagtgtttgatattctctattactactttcatggttatagtaaccatatcaataaccaaaaccaaaaccaaaac |
35060307 |
T |
|
| Q |
108 |
caaactaccattgaattaccaggattgcccttcacactatcgccacgtgacataccttcttttttatttacctcaaatcctagtgtgttgtcctttg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35060308 |
caaactaccattgaattaccaggattgcccttcacactatcgccacgtgacataccttcttttttatttacctcaaatcctagtgtgttgtcttttg |
35060404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University