View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15083_low_1 (Length: 330)
Name: NF15083_low_1
Description: NF15083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15083_low_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 66; Significance: 4e-29; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 1 - 128
Target Start/End: Original strand, 42296584 - 42296711
Alignment:
| Q |
1 |
ttagatagattattaatgtttctcctttgtatatggtgtccctgatnnnnnnngcaaggagaaaatatttgttaaatggcattgagaaatgata-nnnnn |
99 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42296584 |
ttagatagatcattgatgtttctcctttgtatatggtgtccctgataaaaaa-gcaaggagaaaatatttgttaaatggcattgagaaatgatatttttt |
42296682 |
T |
|
| Q |
100 |
nnaaccattttaaaacagtttttgaaata |
128 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
42296683 |
ttaaccattttaaaacagtttttgaaata |
42296711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 111 - 158
Target Start/End: Original strand, 42296860 - 42296907
Alignment:
| Q |
111 |
aaaacagtttttgaaataattctcacttatacttttttctagaagaag |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42296860 |
aaaacagtttttgaaataattctcacttatacttttttctagaagaag |
42296907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University