View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15084_high_22 (Length: 314)
Name: NF15084_high_22
Description: NF15084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15084_high_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 97 - 299
Target Start/End: Original strand, 41084933 - 41085141
Alignment:
| Q |
97 |
taaggtgaaatcaccaaaatagccataatgacacgtggggtgtatattgggtgtttgaaaaaaggatgtctatgaattcataatggccaagattgctttt |
196 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41084933 |
taaggtgaaatcaccaaaatagccctaatgacacgtggggtgtatattgggggtttgaaaaaaggatgtctatgaattcataatggccacgattgctttt |
41085032 |
T |
|
| Q |
197 |
gatacgaagtgtaaatatgaca------gggggaacgtacttaacaccaattttgtgagaagcttgaggttgtcgctatgtacgtcccaaccattttcac |
290 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41085033 |
gatacgaagtgtaaatatgacaaattttgggggaacgtacttaacaccaattttgtgagaagcttgaggttgtcgctatgtacgtcccaaccattttcac |
41085132 |
T |
|
| Q |
291 |
cgtggaaat |
299 |
Q |
| |
|
||||||||| |
|
|
| T |
41085133 |
cgtggaaat |
41085141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 41084837 - 41084889
Alignment:
| Q |
1 |
caaatctgcaacaaggaaataagaaaacctaaacacacggtggtggtggtgtt |
53 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41084837 |
caaatctgcaacaacgaaataagaaaacctaaacacacggtggtggtggtgtt |
41084889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University