View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15084_high_27 (Length: 255)
Name: NF15084_high_27
Description: NF15084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15084_high_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 228
Target Start/End: Original strand, 38238470 - 38238680
Alignment:
| Q |
18 |
aaaggaagacaaacagtgatggattgttcctcgattggttccatggagggaagaaatgcgtcagaagctggcagagtagcgtttatcaacacataagcat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38238470 |
aaaggaagacaaacagtgatggattgttcctcgattggttccatggagggaagaaatgcgtcagaagctggcagagtagcgtttatcaacacataagcat |
38238569 |
T |
 |
| Q |
118 |
caatcccctcttgcatcaggtcgaggatctttcacacgactctttgattactcatgtatgttcaaccatatgcagattaaattgtcggcccgattcagcc |
217 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38238570 |
caatctcctcttgcatcaggttgaggatctttcacacgactctttgattactcatgtatgttcaaccatatgcagattaaattgtcggcccgattcagcc |
38238669 |
T |
 |
| Q |
218 |
atgaaagatat |
228 |
Q |
| |
|
||||||||||| |
|
|
| T |
38238670 |
atgaaagatat |
38238680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 22 - 115
Target Start/End: Original strand, 37070560 - 37070653
Alignment:
| Q |
22 |
gaagacaaacagtgatggattgttcctcgattggttccatggagggaagaaatgcgtcagaagctggcagagtagcgtttatcaacacataagc |
115 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||||| |||| ||| | |||||||| |||||| ||||||||||||| |
|
|
| T |
37070560 |
gaagacaaacagcgatgtattgttcctcgattggttccatggagggaagaaatacgtctgaatccggcagagttgcgtttgtcaacacataagc |
37070653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University