View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15084_high_29 (Length: 250)

Name: NF15084_high_29
Description: NF15084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15084_high_29
NF15084_high_29
[»] chr2 (1 HSPs)
chr2 (181-250)||(3915137-3915206)


Alignment Details
Target: chr2 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 181 - 250
Target Start/End: Original strand, 3915137 - 3915206
Alignment:
181 catcattagattagatggtcaaaatttctgaaatgggtgactaaaattgcacaattagaaagggaacaaa 250  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3915137 catcattagattagatggtcaaaatttctgaaatgggtgactaaaattgcacaattagaaagggaacaaa 3915206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University