View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15084_high_30 (Length: 247)
Name: NF15084_high_30
Description: NF15084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15084_high_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 2 - 232
Target Start/End: Original strand, 42441844 - 42442074
Alignment:
| Q |
2 |
aactaatttatttatgggtgcatgtggacatgtttctttttggccatccctactctcgactcttctttttgtttgttactaaagaataagatttaattta |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
42441844 |
aactaatttatttatgggtgcatgtggacatgtttctttttggccatccctactctcgactcttctttttgtttgttactaaagaataagatttaacttt |
42441943 |
T |
|
| Q |
102 |
taggctcaaatcatatacacaaatagttggtaatgatttgagtcaactcaaacataatttagaattggactcaacaattaactcgttatattgatttata |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
42441944 |
taggctcaaatcatatacacaaatagttggtaatgatttgagtcaactcaaacatagtttagtattgaactcaacaattaacttgttatattgatttatg |
42442043 |
T |
|
| Q |
202 |
aaccaaatgagttgaatttattctgaaaact |
232 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |
|
|
| T |
42442044 |
aaccaaatgagttgaatttattctaaaaact |
42442074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University