View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15084_high_31 (Length: 237)
Name: NF15084_high_31
Description: NF15084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15084_high_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 50 - 229
Target Start/End: Original strand, 33641297 - 33641476
Alignment:
| Q |
50 |
tgatcagttcttgaactgtttatgtctctctcttccgtctctttccttcataacggtttaactcaaagtttcaccaccgtcatcacccttctcgtcacag |
149 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33641297 |
tgatcagatcttgaactgtttatgtctctctcttccgtctctttccttcataacggtttaactcaaagtttcaccaccgtcatcacccttctcgtcacag |
33641396 |
T |
 |
| Q |
150 |
ctacgacaacagccaccatctctttccttttcctttggcttctccgccccaaccactctcgctatctatctcatgtgttt |
229 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33641397 |
ctacgacaacaaccaccatctctttccttttcctttggcttctccgccccaaccactctcgctatctatctcatgtgttt |
33641476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 68 - 229
Target Start/End: Complemental strand, 33311992 - 33311831
Alignment:
| Q |
68 |
tttatgtctctctcttccgtctctttccttcataacggtttaactcaaagtttcaccaccgtcatcacccttctcgtcacagctacgacaacagccacca |
167 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||| ||||||||||| ||||||||||| |||||||||||||| |||||||| || ||||| | |||| |
|
|
| T |
33311992 |
tttatgtttctcttttccgtctctttccttcataactgtttaactcaaggtttcaccaccatcatcacccttctcttcacagctccggcaacaactacca |
33311893 |
T |
 |
| Q |
168 |
tctctttccttttcctttggcttctccgccccaaccactctcgctatctatctcatgtgttt |
229 |
Q |
| |
|
| ||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
33311892 |
tgtctttccttttcctttggcttctccaccccaaccactctcgctatctctctcatgtgttt |
33311831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 76 - 144
Target Start/End: Original strand, 50327293 - 50327361
Alignment:
| Q |
76 |
tctctcttccgtctctttccttcataacggtttaactcaaagtttcaccaccgtcatcacccttctcgt |
144 |
Q |
| |
|
||||||||||||||||||| || ||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
50327293 |
tctctcttccgtctctttcttttggaactgtttaactcaaggtttcaccaccgtcatcacccttctcgt |
50327361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 76 - 144
Target Start/End: Complemental strand, 4153169 - 4153101
Alignment:
| Q |
76 |
tctctcttccgtctctttccttcataacggtttaactcaaagtttcaccaccgtcatcacccttctcgt |
144 |
Q |
| |
|
||||||||||||||||||| ||| ||| ||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
4153169 |
tctctcttccgtctctttctttcggaactgtttaactcaaggtttcaccaccgtcatcatccttctcgt |
4153101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University