View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15084_high_33 (Length: 227)
Name: NF15084_high_33
Description: NF15084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15084_high_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 4 - 222
Target Start/End: Original strand, 33309175 - 33309393
Alignment:
| Q |
4 |
gaagctatctctaacaatcttgagatgacttggagnnnnnnnnnaaggagcatggagtcatggtttttgctattttaaaaaattgaggatggaattgtca |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33309175 |
gaagctatctctaacaatcttgagatgacttggagtttttttttaaggagcatggagtcatggtttttgctattttaaaaaattgatgatggaattgtca |
33309274 |
T |
 |
| Q |
104 |
aacttttatttcaagaacaaaaatgatca-tttttgttattccatctatttgcctcaaaccctttgcactcaccgtcatttccttccatgcaaagcatcc |
202 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33309275 |
cacttttatttcaagaacaaaa-tgatcaatttttgttattccatctatttacctcaaaccctttgcactcaccgtcatttccttccatgcaaagcatcc |
33309373 |
T |
 |
| Q |
203 |
caatttagtactctaacaat |
222 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
33309374 |
caatttagtactctaacaat |
33309393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University