View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15084_high_35 (Length: 220)
Name: NF15084_high_35
Description: NF15084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15084_high_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 159 - 190
Target Start/End: Original strand, 13343968 - 13343999
Alignment:
| Q |
159 |
cgaattcgggattaccaaaactctcttctcat |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
13343968 |
cgaattcgggattaccaaaactctcttctcat |
13343999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University