View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15084_low_28 (Length: 307)
Name: NF15084_low_28
Description: NF15084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15084_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 24 - 288
Target Start/End: Complemental strand, 54628585 - 54628320
Alignment:
| Q |
24 |
tatttggtcttttcatctctcgatgaagagtactttatatgggg-ttgcataatcacatttagaacccacattctttgatgcaccgactagaggatgact |
122 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54628585 |
tatttggtcttttcatctcttgatgaagagtactttatatgggggttgcataatcacatttagaacccacattctttgatgcaccgactagaggatgact |
54628486 |
T |
 |
| Q |
123 |
ttcaagtttatatacataatgttgtgtgtcactttgaacttcagcatgnnnnnnnnaggagaattttagatattgttgtattaaaccatatataatatgg |
222 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |||||| |||||||||||||||||||||||||||||||||| |||||| | |
|
|
| T |
54628485 |
ttcaagtttatatacataatgttgtgtttcactttgaacttaagcatgttttttttgggagaattttagatattgttgtattaaaccatatgtaatattg |
54628386 |
T |
 |
| Q |
223 |
ttactgctccatacaggaacatttccttttcattctcctcagtaaaattaaattcatgtacatggt |
288 |
Q |
| |
|
|| ||||||| | || ||||||| |||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
54628385 |
ttgctgctccgttcaagaacattgccttttcattctcctcggtcaaattaaattcatgtacatggt |
54628320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University