View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15084_low_30 (Length: 262)
Name: NF15084_low_30
Description: NF15084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15084_low_30 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 11 - 141
Target Start/End: Original strand, 5021513 - 5021643
Alignment:
| Q |
11 |
cacagacgagtattttggaagagagcattttttgttggaagaagagcaattttcttacatgtaactatgaaatttatgagtcatagagatattcattcac |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5021513 |
cacacacgagtattttggaagagagcattttttgttgggagaagagcaatttccttacatgtaactatgaaatttatgagtcatagagatattcattcac |
5021612 |
T |
|
| Q |
111 |
accatgcattctgatgttttaggtgttgata |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
5021613 |
accatgcattctgatgttttaggtgttgata |
5021643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 204 - 243
Target Start/End: Original strand, 5021706 - 5021745
Alignment:
| Q |
204 |
ataacacaatttttctttaattgattcatgttcatgtgaa |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5021706 |
ataacacaatttttctttaattgattcatgttcatgtgaa |
5021745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 65
Target Start/End: Complemental strand, 14710118 - 14710078
Alignment:
| Q |
25 |
ttggaagagagcattttttgttggaagaagagcaattttct |
65 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||| |||||| |
|
|
| T |
14710118 |
ttggaagtgagcattttttgttgggagaagagcatttttct |
14710078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University