View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15084_low_39 (Length: 220)

Name: NF15084_low_39
Description: NF15084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15084_low_39
NF15084_low_39
[»] chr2 (1 HSPs)
chr2 (159-190)||(13343968-13343999)


Alignment Details
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 159 - 190
Target Start/End: Original strand, 13343968 - 13343999
Alignment:
159 cgaattcgggattaccaaaactctcttctcat 190  Q
    ||||||||||||||||||||||||||||||||    
13343968 cgaattcgggattaccaaaactctcttctcat 13343999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University