View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15086_high_3 (Length: 351)
Name: NF15086_high_3
Description: NF15086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15086_high_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 35 - 336
Target Start/End: Original strand, 14317326 - 14317621
Alignment:
| Q |
35 |
acattatattgttggtttaaatgtattttttctgcccctgttttataaaattaaattttggttccattatttcaaaatagcgggaaaaaactttgttttt |
134 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
14317326 |
acattatattgttggtttaaatgtattctttgtgcccctgttttataaaattaaattttggttccattatttcaaaatagcgggaaaaaactttgtattt |
14317425 |
T |
|
| Q |
135 |
taagggggataaaacaatgtattatttaacagaaccgataaattcgaactcgaaaccatgcaatatttttcacnnnnnnnnnnnnnnnnnnntaatactg |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14317426 |
taagggggataaaacaa--tattatttaacagaaccgataaattcgaactcgaaaccatgcaatatttttcacaaaaaagaaaaaagaaaaataatactg |
14317523 |
T |
|
| Q |
235 |
atatcactttcaacaacttgattagtctttttcaaacaattgtttttatagaatctttcaaactatttattcttaattgattgatgaaccgacgatcttt |
334 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
14317524 |
atatcactttcaacaacttgattagtctttttcaaacaattgtttttatagaatctttcaaac----tattcttaattgattgatgaaccgacgatcttt |
14317619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University