View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15086_low_2 (Length: 353)
Name: NF15086_low_2
Description: NF15086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15086_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 99 - 339
Target Start/End: Complemental strand, 51705039 - 51704799
Alignment:
| Q |
99 |
cttctcactgcagtaacataaccttttaatgacttttctaagttgtgcttgtatcatatgctaaaattgaatgaacaatcgagatacttatcacttatcc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51705039 |
cttctcactgcagtaacataaccttttaatgacttttctaagttgtgcttgtatcatatgctaaaattgaatgaacaatcgagatacttatcacttatcc |
51704940 |
T |
 |
| Q |
199 |
tttgtaaatnnnnnnnntcaacttacttgagaacaatcattagtaaaagaaacagaccatatcatattagaaatatgggcatatatccacacaccaaaac |
298 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51704939 |
tttgtaaataaaaaaaatcaacttacttgagaacaatcattagtaaaagaaacaaaccatatcatattagaaatatgggcatatatccacacaccaaaac |
51704840 |
T |
 |
| Q |
299 |
acaaaagatgaaatgacacaacatttttacccgcctttgct |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
51704839 |
acaaaagatgaaatgacacaacatttttacccgcctgtgct |
51704799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 51705082 - 51705043
Alignment:
| Q |
20 |
gtaactccattatgccgttgaatgccaacatacataaatt |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51705082 |
gtaactccattatgccgttgaatgccaacatacataaatt |
51705043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University